A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes methods
Show snapshot details
On this page
This experiment, in seven questions
Jump straight to the part of the recipe you need. Data and provenance labels stay close to the action they support.
Shopping and prep list
What do I need before I start?
Biological model pending
Subject model for the experiment.
- Use
- confirm full cohort details in the source paper
Before you run
What should be confirmed before execution?
First confirmation
Species or subject information is missing.
Confirm before execution
Protocol does not list structured equipment.
Confirm before execution
This page shows passages quoted from the paper. Equipment, materials, times, and temperatures are hidden until the page is rebuilt from the full paper and checked by a reviewer. Check the paper before using this method.
Confirm before execution
Open the source paper before finalizing run-specific details.
Procurement checkpoint
Use source-stated vendors where present. Treat mapped products as sourcing options unless the page marks an exact source match.
Open quote workflowStep-by-step procedure
What do I do, in order?
Phenotypic characterization and microdissections.
Microdissection and phenotypic characterization were carried out using Olympus SZX7 optical microscopes. Mosquitoes were collected in Falcon tubes and anesthetized on ice 5 min before dissection. For phenotypic comparison, the legs of the mosquitoes were removed to achieve the profile orientation. Pictures were taken using a HiChrome-SMII GXCAM digital mounted camera (GT Vision). Pictures of gonads were taken using the EVOS imaging system (Thermo-Fisher).
Cage trial assays.
Two cage trials were initiated using 300 wild-type females, 150 wild-type males and 150 dsxF CRISPRh /+ males. The wild-type and dsxF CRISPRh lines were reared in parallel and kept under the same conditions. For the starting generation only, age-matched male and female pupae were allowed to emerge in separate cages and were mixed only when all the pupae had emerged. Both dsxF CRISPRh and wild-type male pupae were screened for the presence of the RFP marker. Mosquitoes were left to mate for 5 days before they were blood fed on anesthetized mice. Two days after, the mosquitoes were set to lay in a 300-ml egg bowl filled with water and lined with filter paper. The eggs produced from the cage were photographed and counted using JMicroVision V1.27. Prior to counting, eggs were dispersed using gentle water spraying in the egg bowl to homogenize the population, and 650 eggs were randomly sel...
PCR of target site and deep sequencing analysis preparation.
For the deep sequence analysis, a limiting PCR reaction was performed on 40 ng of genomic material extracted en masse using the Wizard Genomic DNA purification kit (Promega) from a minimum of 359 mosquitoes taken at G 2, G 3, G 4 and G 5 from both cage experiments. Using the KAPA HiFi HotStart Ready Mix PCR kit (Kapa Biosystems) and primers that carried the Illumina Nextera Transposase adapters (underlined), 4050-Illumina-F ( TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG ACTTATCGGCATCAGTTGCG) and 4050-Illumina-R ( GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GTGAATTCCGTCAGCCAGCA), we amplified a 358-bp locus containing the target site in 50-µl reactions. To maintain the proportion of the reads corresponding to particular alleles at the target site, the PCR reactions were performed under nonsaturating conditions; they were allowed to run for 20 cycles before 25 µl were removed and stored at W...
In vitro cleavage assay against wild-type and SNP variant target site.
We performed an in vitro cleavage assay to test the ability of the gRNA used in this study to cleave the target site that incorporates the SNP found in wild populations in Africa ( ). Using Golden Gate cloning and primers modified to carry suitable overhangs, we introduced the two target sequences separately into a 2-kb plasmid. As a control, we also prepared a plasmid that carries a modified version of the dsx target site without the SNP that lacks the PAM sequence, necessary for Cas9 cleavage. All three vectors were linearized and verified on a gel before the cleavage assay. For the cleavage assay we used a ready-to-use sgRNA provided by Synthego (USA) and S. pyogenes Cas9 nuclease in the form of enzyme (NEB). To form ribonucleoprotein particles (RNPs), we mixed a 1:1 molar ration of the sgRNA and the Cas9 protein into a 40-µl reaction to a final concentration of 400 nM and lef...
Supplementary Information
Phenotypic assays were performed to measure fertility and transmission rates for each gene drive based upon the vasa and zpg promoters. The data for the vasa-CRISPR h is previously reported in Hammond et al. (2016). The zpg-CRISPR h construct targeting AGAP007280 recognised exactly the same target site and was inserted in identical fashion to the vasa-CRISPR h, through recombinase-mediated cassette exchange 9. The larval output was determined for individual drive heterozygotes crossed to wild type (left), and their progeny scored for the presence of DsRed linked to the construct (right). The average progeny count and transmission rate is also shown (± s.e.m.).
Measurement outputs
What raw and processed outputs should exist?
Analysis plan
How should the outputs become interpretable results?
Acquisition
Collect raw experimental outputs with enough metadata to preserve sample identity, condition, and timing.
inferred from protocolPreprocessing / cleaning
Review raw outputs for quality, remove unusable captures, and organize the data into a comparison-ready table or image set.
inferred from protocolScoring or quantification
Quantify the primary endpoint described in the methods before moving into any statistical comparison.
inferred from protocolStatistical comparison
Statistical method not yet structured for this page.
inferred from protocolReporting output
Report representative outputs alongside the summary comparison used to support the conclusion.
inferred from protocolSource and audit
What supports the facts on this page?
Evidence quotes (5)
Microdissection and phenotypic characterization were carried out using Olympus SZX7 optical microscopes. Mosquitoes were collected in Falcon tubes and anesthetized on ice 5 min before dissection. For phenotypic comparison, the legs of the mosquitoes were removed to achieve the profile orientation. Pictures were taken using a HiChrome-SMII GXCAM digital mounted camera (GT Vision). Pictures of gonads were taken using the EVOS imaging system (Thermo-Fisher).
Two cage trials were initiated using 300 wild-type females, 150 wild-type males and 150 dsxF CRISPRh /+ males. The wild-type and dsxF CRISPRh lines were reared in parallel and kept under the same conditions. For the starting generation only, age-matched male and female pupae were allowed to emerge in separate cages and were mixed only when all the pupae had emerged. Both dsxF CRISPRh and wild-type male pupae were screened for the presence of the RFP marker. Mosquitoes were left to mate for 5 days before they were blood fed on anesthetized mice. Two days after, the mosquitoes were set to lay in a 300-ml egg bowl filled with water and lined with filter paper. The eggs produced from the cage were photographed and counted using JMicroVision V1.27. Prior to counting, eggs were dispersed using gentle water spraying in the egg bowl to homogenize the population, and 650 eggs were randomly selected to seed the next generation. Larvae emerging from the 650 eggs were counted and screened for the presence of the RFP marker to score the transgenic rate of the progeny. The number of pupae used to seed the next generation was also recorded.
For the deep sequence analysis, a limiting PCR reaction was performed on 40 ng of genomic material extracted en masse using the Wizard Genomic DNA purification kit (Promega) from a minimum of 359 mosquitoes taken at G 2, G 3, G 4 and G 5 from both cage experiments. Using the KAPA HiFi HotStart Ready Mix PCR kit (Kapa Biosystems) and primers that carried the Illumina Nextera Transposase adapters (underlined), 4050-Illumina-F ( TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG ACTTATCGGCATCAGTTGCG) and 4050-Illumina-R ( GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GTGAATTCCGTCAGCCAGCA), we amplified a 358-bp locus containing the target site in 50-µl reactions. To maintain the proportion of the reads corresponding to particular alleles at the target site, the PCR reactions were performed under nonsaturating conditions; they were allowed to run for 20 cycles before 25 µl were removed and stored at -20 °C. The remnant 25 µl were run for another 20 cycles and used to verify the amplification on an agarose gel. Annealing time and temperature were adjusted to 68 °C for 20 s to minimize off-target amplification.
We performed an in vitro cleavage assay to test the ability of the gRNA used in this study to cleave the target site that incorporates the SNP found in wild populations in Africa ( ). Using Golden Gate cloning and primers modified to carry suitable overhangs, we introduced the two target sequences separately into a 2-kb plasmid. As a control, we also prepared a plasmid that carries a modified version of the dsx target site without the SNP that lacks the PAM sequence, necessary for Cas9 cleavage. All three vectors were linearized and verified on a gel before the cleavage assay. For the cleavage assay we used a ready-to-use sgRNA provided by Synthego (USA) and S. pyogenes Cas9 nuclease in the form of enzyme (NEB). To form ribonucleoprotein particles (RNPs), we mixed a 1:1 molar ration of the sgRNA and the Cas9 protein into a 40-µl reaction to a final concentration of 400 nM and left it to incubate at room temperature for 10 min. The linearized substrate was added to the reactions in a final concentration of 40 nM in a final volume of 50 µl and incubated at 37 °C for 30 min. Proteinase K was added to stop the reaction and 20 µl were verified on a gel. The primer...
Phenotypic assays were performed to measure fertility and transmission rates for each gene drive based upon the vasa and zpg promoters. The data for the vasa-CRISPR h is previously reported in Hammond et al. (2016). The zpg-CRISPR h construct targeting AGAP007280 recognised exactly the same target site and was inserted in identical fashion to the vasa-CRISPR h, through recombinase-mediated cassette exchange 9. The larval output was determined for individual drive heterozygotes crossed to wild type (left), and their progeny scored for the presence of DsRed linked to the construct (right). The average progeny count and transmission rate is also shown (± s.e.m.).
Machine-readable layer
[
{
"@context": "https://schema.org",
"@type": "HowTo",
"name": "A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes methods",
"description": "Protocol for A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes methods",
"step": [
{
"@type": "HowToStep",
"position": 1,
"name": "Phenotypic characterization and microdissections.",
"text": "Microdissection and phenotypic characterization were carried out using Olympus SZX7 optical microscopes. Mosquitoes were collected in Falcon tubes and anesthetized on ice 5 min before dissection. For phenotypic comparison, the legs of the mosquitoes were removed to achieve the profile orientation. Pictures were taken using a HiChrome-SMII GXCAM digital mounted camera (GT Vision). Pictures of gonads were taken using the EVOS imaging system (Thermo-Fisher)."
},
{
"@type": "HowToStep",
"position": 2,
"name": "Cage trial assays.",
"text": "Two cage trials were initiated using 300 wild-type females, 150 wild-type males and 150 dsxF CRISPRh /+ males. The wild-type and dsxF CRISPRh lines were reared in parallel and kept under the same conditions. For the starting generation only, age-matched male and female pupae were allowed to emerge in separate cages and were mixed only when all the pupae had emerged. Both dsxF CRISPRh and wild-type male pupae were screened for the presence of the RFP marker. Mosquitoes were left to mate for 5 days before they were blood fed on anesthetized mice. Two days after, the mosquitoes were set to lay in a 300-ml egg bowl filled with water and lined with filter paper. The eggs produced from the cage were photographed and counted using JMicroVision V1.27. Prior to counting, eggs were dispersed using gentle water spraying in the egg bowl to homogenize the population, and 650 eggs were randomly sel..."
},
{
"@type": "HowToStep",
"position": 3,
"name": "PCR of target site and deep sequencing analysis preparation.",
"text": "For the deep sequence analysis, a limiting PCR reaction was performed on 40 ng of genomic material extracted en masse using the Wizard Genomic DNA purification kit (Promega) from a minimum of 359 mosquitoes taken at G 2, G 3, G 4 and G 5 from both cage experiments. Using the KAPA HiFi HotStart Ready Mix PCR kit (Kapa Biosystems) and primers that carried the Illumina Nextera Transposase adapters (underlined), 4050-Illumina-F ( TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG ACTTATCGGCATCAGTTGCG) and 4050-Illumina-R ( GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GTGAATTCCGTCAGCCAGCA), we amplified a 358-bp locus containing the target site in 50-µl reactions. To maintain the proportion of the reads corresponding to particular alleles at the target site, the PCR reactions were performed under nonsaturating conditions; they were allowed to run for 20 cycles before 25 µl were removed and stored at W..."
},
{
"@type": "HowToStep",
"position": 4,
"name": "In vitro cleavage assay against wild-type and SNP variant target site.",
"text": "We performed an in vitro cleavage assay to test the ability of the gRNA used in this study to cleave the target site that incorporates the SNP found in wild populations in Africa ( ). Using Golden Gate cloning and primers modified to carry suitable overhangs, we introduced the two target sequences separately into a 2-kb plasmid. As a control, we also prepared a plasmid that carries a modified version of the dsx target site without the SNP that lacks the PAM sequence, necessary for Cas9 cleavage. All three vectors were linearized and verified on a gel before the cleavage assay. For the cleavage assay we used a ready-to-use sgRNA provided by Synthego (USA) and S. pyogenes Cas9 nuclease in the form of enzyme (NEB). To form ribonucleoprotein particles (RNPs), we mixed a 1:1 molar ration of the sgRNA and the Cas9 protein into a 40-µl reaction to a final concentration of 400 nM and lef..."
},
{
"@type": "HowToStep",
"position": 5,
"name": "Supplementary Information",
"text": "Phenotypic assays were performed to measure fertility and transmission rates for each gene drive based upon the vasa and zpg promoters. The data for the vasa-CRISPR h is previously reported in Hammond et al. (2016). The zpg-CRISPR h construct targeting AGAP007280 recognised exactly the same target site and was inserted in identical fashion to the vasa-CRISPR h, through recombinase-mediated cassette exchange 9. The larval output was determined for individual drive heterozygotes crossed to wild type (left), and their progeny scored for the presence of DsRed linked to the construct (right). The average progeny count and transmission rate is also shown (± s.e.m.)."
}
],
"tool": [],
"supply": [],
"isBasedOn": {
"@type": "ScholarlyArticle",
"headline": "A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes",
"datePublished": "2018",
"author": [
{
"@type": "Person",
"name": "Kyros Kyrou"
},
{
"@type": "Person",
"name": "Andrew M Hammond"
},
{
"@type": "Person",
"name": "Roberto Galizi"
},
{
"@type": "Person",
"name": "Nace Kranjc"
},
{
"@type": "Person",
"name": "Austin Burt"
},
{
"@type": "Person",
"name": "Andrea K Beaghton"
},
{
"@type": "Person",
"name": "Tony Nolan"
},
{
"@type": "Person",
"name": "Andrea Crisanti"
}
],
"identifier": "10.1038/nbt.4245"
}
},
{
"@context": "https://schema.org",
"@type": "BreadcrumbList",
"itemListElement": [
{
"@type": "ListItem",
"position": 1,
"name": "Experiments",
"item": "https://replicatescience.com/experiments"
},
{
"@type": "ListItem",
"position": 2,
"name": "A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes methods",
"item": "https://replicatescience.com/experiments/a-crispr-8211-cas9-gene-drive-targeting-doublesex-causes-complete-population-suppression-in-caged-anopheles-gambiae-mosquitoes-methods-kyros-kyrou-pmc6871539/a-crispr-cas9-gene-drive-targeting-doublesex-causes-complete-population-suppression-in-caged-anophel-mlph7bz2"
}
]
}
]