A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes methods
Aim. Evidence-backed execution summary for A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes methods from A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes.
Show snapshot details
On this page
This experiment, in seven questions
Jump straight to the part of the recipe you need. Data and provenance labels stay close to the action they support.
Shopping and prep list
What do I need before I start?
human
Subject model for the experiment.
- Use
- confirm full cohort details in the source paper
Microinjection of embryos and selection of transformed mosquitoes.
reagent used in the protocol.
- Use
- All mosquitoes were reared under standard conditions of 80% relative humidity and 28 °C. The mosquitoes were blood-fed on anesthetized mice, and freshly laid embryos were aligned and used for microinjections as described before. We injected embryos with solution containing both p16510 and pK101 (each at 300 ng...
Molecular confirmation of gene targeting and cassette integration.
reagent used in the protocol.
- Use
- Successful integration of dsxF - and dsxF CRISPRh cassettes into Agdsx at exon 5 was confirmed by PCR using genomic DNA extracted using the Wizard Genomic DNA purification kit (Promega). Generation of the HDR-mediated dsxF - allele was confirmed using primers binding the integrated cassette (GFP-F and 3x...
Molecular confirmation of gene targeting and cassette integration.
reagent used in the protocol.
- Use
- RCME of the dsxF CRISPRh construct into the dsx locus was confirmed using primers binding the drive cassette (hCas9-F and RFP-R) and the neighboring genomic integration site (dsxin4-F and dsxex5-R1). Primer sequences can be found in.
PCR of target site and deep sequencing analysis preparation.
reagent used in the protocol.
- Use
- For the deep sequence analysis, a limiting PCR reaction was performed on 40 ng of genomic material extracted en masse using the Wizard Genomic DNA purification kit (Promega) from a minimum of 359 mosquitoes taken at G 2, G 3, G 4 and G 5 from both cage experiments. Using the KAPA HiFi HotStart Ready Mix PCR kit (K...
PCR of target site and deep sequencing analysis preparation.
reagent used in the protocol.
- Use
- Libraries were prepared in accordance with the Illumina 16S Metagenomic Sequencing Library Preparation protocol and the Nextera XT Index Kit. AMPure XP beads were used to purify the amplicons. Dual indices and Illumina sequencing adapters were attached in a second PCR step using the Nextera XT Indexing Kit and purif...
In vitro cleavage assay against wild-type and SNP variant target site.
reagent used in the protocol.
- Use
- We performed an in vitro cleavage assay to test the ability of the gRNA used in this study to cleave the target site that incorporates the SNP found in wild populations in Africa ( ). Using Golden Gate cloning and primers modified to carry suitable overhangs, we introduced the two target sequences separately into a...
Supplementary Information
reagent used in the protocol.
- Use
- An in vitro cleavage assay using an RNP complex of Cas9 enzyme and the gRNA used in this study was performed against linearised plasmids containing either wild-type (WT) target site in dsx exon 5 or the same site containing the single SNP found in wild caught populations (SNP). Products of the in vitro cleavage assa...
Potential for resistance to dsx gene drive
We monitored the occurrence of mutations at the drive target site in generations 2, 3, 4 and 5 to identify the occurrence of nuclease-resistant, functional variants. Amplicon sequencing of the target sequence from pooled samples containing a minimum of 359 mosquitoes, which were collected in generations 2-5, r...
- Use
- We monitored the occurrence of mutations at the drive target site in generations 2, 3, 4 and 5 to identify the occurrence of nuclease-resistant, functional variants. Amplicon sequencing of the target sequence from pooled samples containing a minimum of 359 mosquitoes, which were collected in generations 2-5, r...
Microinjection of embryos and selection of transformed mosquitoes.
All mosquitoes were reared under standard conditions of 80% relative humidity and 28 °C. The mosquitoes were blood-fed on anesthetized mice, and freshly laid embryos were aligned and used for microinjections as described before. We injected embryos with solution containing both p16510 and pK101 (each at 300 ng...
- Use
- All mosquitoes were reared under standard conditions of 80% relative humidity and 28 °C. The mosquitoes were blood-fed on anesthetized mice, and freshly laid embryos were aligned and used for microinjections as described before. We injected embryos with solution containing both p16510 and pK101 (each at 300 ng...
Phenotypic characterization and microdissections.
Microdissection and phenotypic characterization were carried out using Olympus SZX7 optical microscopes. Mosquitoes were collected in Falcon tubes and anesthetized on ice 5 min before dissection. For phenotypic comparison, the legs of the mosquitoes were removed to achieve the profile orientation. Pictures were take...
- Use
- Microdissection and phenotypic characterization were carried out using Olympus SZX7 optical microscopes. Mosquitoes were collected in Falcon tubes and anesthetized on ice 5 min before dissection. For phenotypic comparison, the legs of the mosquitoes were removed to achieve the profile orientation. Pictures were take...
PCR of target site and deep sequencing analysis preparation.
For the deep sequence analysis, a limiting PCR reaction was performed on 40 ng of genomic material extracted en masse using the Wizard Genomic DNA purification kit (Promega) from a minimum of 359 mosquitoes taken at G 2, G 3, G 4 and G 5 from both cage experiments. Using the KAPA HiFi HotStart Ready Mix PCR kit (K...
- Use
- For the deep sequence analysis, a limiting PCR reaction was performed on 40 ng of genomic material extracted en masse using the Wizard Genomic DNA purification kit (Promega) from a minimum of 359 mosquitoes taken at G 2, G 3, G 4 and G 5 from both cage experiments. Using the KAPA HiFi HotStart Ready Mix PCR kit (K...
PCR of target site and deep sequencing analysis preparation.
Libraries were prepared in accordance with the Illumina 16S Metagenomic Sequencing Library Preparation protocol and the Nextera XT Index Kit. AMPure XP beads were used to purify the amplicons. Dual indices and Illumina sequencing adapters were attached in a second PCR step using the Nextera XT Indexing Kit and purif...
- Use
- Libraries were prepared in accordance with the Illumina 16S Metagenomic Sequencing Library Preparation protocol and the Nextera XT Index Kit. AMPure XP beads were used to purify the amplicons. Dual indices and Illumina sequencing adapters were attached in a second PCR step using the Nextera XT Indexing Kit and purif...
Deep sequencing analysis.
We ran CRISPResso software v1.0.8 on raw sequencing data to detect mutations at the target site using parameter -q 30, setting the minimum average read quality score (phred33) to 30. Raw sequencing data was deposited in the NCBI BioProject database (accession code PRJNA476358 ). Resulting allele frequency tables wer...
- Use
- We ran CRISPResso software v1.0.8 on raw sequencing data to detect mutations at the target site using parameter -q 30, setting the minimum average read quality score (phred33) to 30. Raw sequencing data was deposited in the NCBI BioProject database (accession code PRJNA476358 ). Resulting allele frequency tables wer...
Data availability.
Raw sequencing data were deposited in the NCBI BioProject database under accession code PRJNA476358.
- Use
- Raw sequencing data were deposited in the NCBI BioProject database under accession code PRJNA476358.
Supplementary Information
Pooled amplicon sequencing of the target site from 4 generations of the cage experiment (generations 2, 3, 4 and 5) revealed a range of very low frequency indels at the target site ( a ), none of which showed any sign of positive selection. Insertion, deletion and substitution frequencies per nucleotide position wer...
- Use
- Pooled amplicon sequencing of the target site from 4 generations of the cage experiment (generations 2, 3, 4 and 5) revealed a range of very low frequency indels at the target site ( a ), none of which showed any sign of positive selection. Insertion, deletion and substitution frequencies per nucleotide position wer...
Before you run
What should be confirmed before execution?
First confirmation
Equipment is listed but no product mappings are linked.
Confirm before execution
This page is backed by a publishable Replication Data Ledger package with zero critical source-verification issues.
Confirm before execution
Open the source paper before finalizing run-specific details.
Procurement checkpoint
Use source-stated vendors where present. Treat mapped products as sourcing options unless the page marks an exact source match.
Open quote workflowStep-by-step procedure
What do I do, in order?
Phenotypic characterization and microdissections.
Microdissection and phenotypic characterization were carried out using Olympus SZX7 optical microscopes. Mosquitoes were collected in Falcon tubes and anesthetized on ice 5 min before dissection. For phenotypic comparison, the legs of the mosquitoes were removed to achieve the profile orientation. Pictures were taken using a HiChrome-SMII GXCAM digital mounted camera (GT Vision). Pictures of gonads were taken using the EVOS imaging system (Thermo-Fisher).
Cage trial assays.
Two cage trials were initiated using 300 wild-type females, 150 wild-type males and 150 dsxF CRISPRh /+ males. The wild-type and dsxF CRISPRh lines were reared in parallel and kept under the same conditions. For the starting generation only, age-matched male and female pupae were allowed to emerge in separate cages and were mixed only when all the pupae had emerged. Both dsxF CRISPRh and wild-type male pupae were screened for the presence of the RFP marker. Mosquitoes were left to mate for 5 days before they were blood fed on anesthetized mice. Two days after, the mosquitoes were set to lay in a 300-ml egg bowl filled with water and lined with filter paper. The eggs produced from the cage were photographed and counted using JMicroVision V1.27. Prior to counting, eggs were dispersed using gentle water spraying in the egg bowl to homogenize the population, and 650 eggs were randomly sel...
PCR of target site and deep sequencing analysis preparation.
For the deep sequence analysis, a limiting PCR reaction was performed on 40 ng of genomic material extracted en masse using the Wizard Genomic DNA purification kit (Promega) from a minimum of 359 mosquitoes taken at G 2, G 3, G 4 and G 5 from both cage experiments. Using the KAPA HiFi HotStart Ready Mix PCR kit (Kapa Biosystems) and primers that carried the Illumina Nextera Transposase adapters (underlined), 4050-Illumina-F ( TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG ACTTATCGGCATCAGTTGCG) and 4050-Illumina-R ( GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GTGAATTCCGTCAGCCAGCA), we amplified a 358-bp locus containing the target site in 50-µl reactions. To maintain the proportion of the reads corresponding to particular alleles at the target site, the PCR reactions were performed under nonsaturating conditions; they were allowed to run for 20 cycles before 25 µl were removed and stored at W...
In vitro cleavage assay against wild-type and SNP variant target site.
We performed an in vitro cleavage assay to test the ability of the gRNA used in this study to cleave the target site that incorporates the SNP found in wild populations in Africa ( ). Using Golden Gate cloning and primers modified to carry suitable overhangs, we introduced the two target sequences separately into a 2-kb plasmid. As a control, we also prepared a plasmid that carries a modified version of the dsx target site without the SNP that lacks the PAM sequence, necessary for Cas9 cleavage. All three vectors were linearized and verified on a gel before the cleavage assay. For the cleavage assay we used a ready-to-use sgRNA provided by Synthego (USA) and S. pyogenes Cas9 nuclease in the form of enzyme (NEB). To form ribonucleoprotein particles (RNPs), we mixed a 1:1 molar ration of the sgRNA and the Cas9 protein into a 40-µl reaction to a final concentration of 400 nM and lef...
Supplementary Information
Phenotypic assays were performed to measure fertility and transmission rates for each gene drive based upon the vasa and zpg promoters. The data for the vasa-CRISPR h is previously reported in Hammond et al. (2016). The zpg-CRISPR h construct targeting AGAP007280 recognised exactly the same target site and was inserted in identical fashion to the vasa-CRISPR h, through recombinase-mediated cassette exchange 9. The larval output was determined for individual drive heterozygotes crossed to wild type (left), and their progeny scored for the presence of DsRed linked to the construct (right). The average progeny count and transmission rate is also shown (± s.e.m.).
Measurement outputs
What raw and processed outputs should exist?
However, several technical and scientific issues remain before these proof-of-principle demonstrations are advanced to effect vector population suppression. The development of a...
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
We used recombinase-mediated cassette exchange to replace the 3xP3::GFP transcription unit with a dsxF CRISPRh gene drive construct that comprised an RFP marker gene, a transcri...
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
Using a mathematical model that includes the inheritance bias of the construct, the fecundity of heterozygous individuals, the phenotype of intersex, and the effect of the pater...
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
Our data not only provide important functional insights into the role of dsx in A. gambiae sex determination, but also represent a substantial step toward the development of eff...
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
Analysis plan
How should the outputs become interpretable results?
Acquisition
Collect raw experimental outputs with enough metadata to preserve sample identity, condition, and timing.
inferred from protocolPreprocessing / cleaning
Phenotypic assays designed to examine relative fecundity in mosquitoes carrying either dsxF - or dsxF CRISPRh alleles were carried out essentially as described before.
from paperScoring or quantification
Quantify the primary readouts for this experiment: However, several technical and scientific issues remain before these proof-of-principle demonstrations are advanced to effect vector population suppression. The development of a...; We used recombinase-mediated cassette exchange to replace the 3xP3::GFP transcription unit with a dsxF CRISPRh gene drive construct that comprised an RFP marker gene, a transcri...; Using a mathematical model that includes the inheritance bias of the construct, the fecundity of heterozygous individuals, the phenotype of intersex, and the effect of the pater...; Our data not only provide important functional insights into the role of dsx in A. gambiae sex determination, but also represent a substantial step toward the development of eff....
from paperStatistical comparison
Phenotypic assays designed to examine relative fecundity in mosquitoes carrying either dsxF - or dsxF CRISPRh alleles were carried out essentially as described before. Br...; Male and female dsxF CRISPRh heterozygotes ( dsxF CRISPRh /+) that had inherited a maternal or paternal copy of the driving allele were crossed to wild type and assessed for inh...; Pooled amplicon sequencing of the target site from 4 generations of the cage experiment (generations 2, 3, 4 and 5) revealed a range of very low frequency indels at the target s...
from paperReporting output
Report representative outputs alongside summary comparisons for However, several technical and scientific issues remain before these proof-of-principle demonstrations are advanced to effect vector population suppression. The development of a..., We used recombinase-mediated cassette exchange to replace the 3xP3::GFP transcription unit with a dsxF CRISPRh gene drive construct that comprised an RFP marker gene, a transcri..., Using a mathematical model that includes the inheritance bias of the construct, the fecundity of heterozygous individuals, the phenotype of intersex, and the effect of the pater..., Our data not only provide important functional insights into the role of dsx in A. gambiae sex determination, but also represent a substantial step toward the development of eff....
inferred from protocolStructured statistical methods
Phenotypic assays designed to examine relative fecundity in mosquitoes carrying either dsxF - or dsxF CRISPRh alleles were carried out essentially as described before. Br...; Male and female dsxF CRISPRh heterozygotes ( dsxF CRISPRh /+) that had inherited a maternal or paternal copy of the driving allele were crossed to wild type and assessed for inh...; Pooled amplicon sequencing of the target site from 4 generations of the cage experiment (generations 2, 3, 4 and 5) revealed a range of very low frequency indels at the target s...
source structuredSource and audit
What supports the facts on this page?
Evidence quotes (5)
Microdissection and phenotypic characterization were carried out using Olympus SZX7 optical microscopes. Mosquitoes were collected in Falcon tubes and anesthetized on ice 5 min before dissection. For phenotypic comparison, the legs of the mosquitoes were removed to achieve the profile orientation. Pictures were taken using a HiChrome-SMII GXCAM digital mounted camera (GT Vision). Pictures of gonads were taken using the EVOS imaging system (Thermo-Fisher).
Two cage trials were initiated using 300 wild-type females, 150 wild-type males and 150 dsxF CRISPRh /+ males. The wild-type and dsxF CRISPRh lines were reared in parallel and kept under the same conditions. For the starting generation only, age-matched male and female pupae were allowed to emerge in separate cages and were mixed only when all the pupae had emerged. Both dsxF CRISPRh and wild-type male pupae were screened for the presence of the RFP marker. Mosquitoes were left to mate for 5 days before they were blood fed on anesthetized mice. Two days after, the mosquitoes were set to lay in a 300-ml egg bowl filled with water and lined with filter paper. The eggs produced from the cage were photographed and counted using JMicroVision V1.27. Prior to counting, eggs were dispersed using gentle water spraying in the egg bowl to homogenize the population, and 650 eggs were randomly selected to seed the next generation. Larvae emerging from the 650 eggs were counted and screened for the presence of the RFP marker to score the transgenic rate of the progeny. The number of pupae used to seed the next generation was also recorded.
For the deep sequence analysis, a limiting PCR reaction was performed on 40 ng of genomic material extracted en masse using the Wizard Genomic DNA purification kit (Promega) from a minimum of 359 mosquitoes taken at G 2, G 3, G 4 and G 5 from both cage experiments. Using the KAPA HiFi HotStart Ready Mix PCR kit (Kapa Biosystems) and primers that carried the Illumina Nextera Transposase adapters (underlined), 4050-Illumina-F ( TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG ACTTATCGGCATCAGTTGCG) and 4050-Illumina-R ( GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GTGAATTCCGTCAGCCAGCA), we amplified a 358-bp locus containing the target site in 50-µl reactions. To maintain the proportion of the reads corresponding to particular alleles at the target site, the PCR reactions were performed under nonsaturating conditions; they were allowed to run for 20 cycles before 25 µl were removed and stored at -20 °C. The remnant 25 µl were run for another 20 cycles and used to verify the amplification on an agarose gel. Annealing time and temperature were adjusted to 68 °C for 20 s to minimize off-target amplification.
We performed an in vitro cleavage assay to test the ability of the gRNA used in this study to cleave the target site that incorporates the SNP found in wild populations in Africa ( ). Using Golden Gate cloning and primers modified to carry suitable overhangs, we introduced the two target sequences separately into a 2-kb plasmid. As a control, we also prepared a plasmid that carries a modified version of the dsx target site without the SNP that lacks the PAM sequence, necessary for Cas9 cleavage. All three vectors were linearized and verified on a gel before the cleavage assay. For the cleavage assay we used a ready-to-use sgRNA provided by Synthego (USA) and S. pyogenes Cas9 nuclease in the form of enzyme (NEB). To form ribonucleoprotein particles (RNPs), we mixed a 1:1 molar ration of the sgRNA and the Cas9 protein into a 40-µl reaction to a final concentration of 400 nM and left it to incubate at room temperature for 10 min. The linearized substrate was added to the reactions in a final concentration of 40 nM in a final volume of 50 µl and incubated at 37 °C for 30 min. Proteinase K was added to stop the reaction and 20 µl were verified on a gel. The primer...
Phenotypic assays were performed to measure fertility and transmission rates for each gene drive based upon the vasa and zpg promoters. The data for the vasa-CRISPR h is previously reported in Hammond et al. (2016). The zpg-CRISPR h construct targeting AGAP007280 recognised exactly the same target site and was inserted in identical fashion to the vasa-CRISPR h, through recombinase-mediated cassette exchange 9. The larval output was determined for individual drive heterozygotes crossed to wild type (left), and their progeny scored for the presence of DsRed linked to the construct (right). The average progeny count and transmission rate is also shown (± s.e.m.).
Machine-readable layer
[
{
"@context": "https://schema.org",
"@type": "HowTo",
"name": "A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes methods",
"description": "Evidence-backed execution summary for A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes methods from A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes.",
"totalTime": "PT2415M",
"step": [
{
"@type": "HowToStep",
"position": 1,
"name": "Phenotypic characterization and microdissections.",
"text": "Microdissection and phenotypic characterization were carried out using Olympus SZX7 optical microscopes. Mosquitoes were collected in Falcon tubes and anesthetized on ice 5 min before dissection. For phenotypic comparison, the legs of the mosquitoes were removed to achieve the profile orientation. Pictures were taken using a HiChrome-SMII GXCAM digital mounted camera (GT Vision). Pictures of gonads were taken using the EVOS imaging system (Thermo-Fisher)."
},
{
"@type": "HowToStep",
"position": 2,
"name": "Cage trial assays.",
"text": "Two cage trials were initiated using 300 wild-type females, 150 wild-type males and 150 dsxF CRISPRh /+ males. The wild-type and dsxF CRISPRh lines were reared in parallel and kept under the same conditions. For the starting generation only, age-matched male and female pupae were allowed to emerge in separate cages and were mixed only when all the pupae had emerged. Both dsxF CRISPRh and wild-type male pupae were screened for the presence of the RFP marker. Mosquitoes were left to mate for 5 days before they were blood fed on anesthetized mice. Two days after, the mosquitoes were set to lay in a 300-ml egg bowl filled with water and lined with filter paper. The eggs produced from the cage were photographed and counted using JMicroVision V1.27. Prior to counting, eggs were dispersed using gentle water spraying in the egg bowl to homogenize the population, and 650 eggs were randomly sel..."
},
{
"@type": "HowToStep",
"position": 3,
"name": "PCR of target site and deep sequencing analysis preparation.",
"text": "For the deep sequence analysis, a limiting PCR reaction was performed on 40 ng of genomic material extracted en masse using the Wizard Genomic DNA purification kit (Promega) from a minimum of 359 mosquitoes taken at G 2, G 3, G 4 and G 5 from both cage experiments. Using the KAPA HiFi HotStart Ready Mix PCR kit (Kapa Biosystems) and primers that carried the Illumina Nextera Transposase adapters (underlined), 4050-Illumina-F ( TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG ACTTATCGGCATCAGTTGCG) and 4050-Illumina-R ( GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GTGAATTCCGTCAGCCAGCA), we amplified a 358-bp locus containing the target site in 50-µl reactions. To maintain the proportion of the reads corresponding to particular alleles at the target site, the PCR reactions were performed under nonsaturating conditions; they were allowed to run for 20 cycles before 25 µl were removed and stored at W..."
},
{
"@type": "HowToStep",
"position": 4,
"name": "In vitro cleavage assay against wild-type and SNP variant target site.",
"text": "We performed an in vitro cleavage assay to test the ability of the gRNA used in this study to cleave the target site that incorporates the SNP found in wild populations in Africa ( ). Using Golden Gate cloning and primers modified to carry suitable overhangs, we introduced the two target sequences separately into a 2-kb plasmid. As a control, we also prepared a plasmid that carries a modified version of the dsx target site without the SNP that lacks the PAM sequence, necessary for Cas9 cleavage. All three vectors were linearized and verified on a gel before the cleavage assay. For the cleavage assay we used a ready-to-use sgRNA provided by Synthego (USA) and S. pyogenes Cas9 nuclease in the form of enzyme (NEB). To form ribonucleoprotein particles (RNPs), we mixed a 1:1 molar ration of the sgRNA and the Cas9 protein into a 40-µl reaction to a final concentration of 400 nM and lef..."
},
{
"@type": "HowToStep",
"position": 5,
"name": "Supplementary Information",
"text": "Phenotypic assays were performed to measure fertility and transmission rates for each gene drive based upon the vasa and zpg promoters. The data for the vasa-CRISPR h is previously reported in Hammond et al. (2016). The zpg-CRISPR h construct targeting AGAP007280 recognised exactly the same target site and was inserted in identical fashion to the vasa-CRISPR h, through recombinase-mediated cassette exchange 9. The larval output was determined for individual drive heterozygotes crossed to wild type (left), and their progeny scored for the presence of DsRed linked to the construct (right). The average progeny count and transmission rate is also shown (± s.e.m.)."
}
],
"tool": [
{
"@type": "HowToTool",
"name": "Potential for resistance to dsx gene drive"
},
{
"@type": "HowToTool",
"name": "Microinjection of embryos and selection of transformed mosquitoes."
},
{
"@type": "HowToTool",
"name": "Phenotypic characterization and microdissections."
},
{
"@type": "HowToTool",
"name": "PCR of target site and deep sequencing analysis preparation."
},
{
"@type": "HowToTool",
"name": "PCR of target site and deep sequencing analysis preparation."
},
{
"@type": "HowToTool",
"name": "Deep sequencing analysis."
},
{
"@type": "HowToTool",
"name": "Data availability."
},
{
"@type": "HowToTool",
"name": "Supplementary Information"
}
],
"supply": [
{
"@type": "HowToSupply",
"name": "Microinjection of embryos and selection of transformed mosquitoes."
},
{
"@type": "HowToSupply",
"name": "Molecular confirmation of gene targeting and cassette integration."
},
{
"@type": "HowToSupply",
"name": "Molecular confirmation of gene targeting and cassette integration."
},
{
"@type": "HowToSupply",
"name": "PCR of target site and deep sequencing analysis preparation."
},
{
"@type": "HowToSupply",
"name": "PCR of target site and deep sequencing analysis preparation."
},
{
"@type": "HowToSupply",
"name": "In vitro cleavage assay against wild-type and SNP variant target site."
},
{
"@type": "HowToSupply",
"name": "Supplementary Information"
}
],
"isBasedOn": {
"@type": "ScholarlyArticle",
"headline": "A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes",
"datePublished": "2018",
"author": [
{
"@type": "Person",
"name": "Kyros Kyrou"
},
{
"@type": "Person",
"name": "Andrew M Hammond"
},
{
"@type": "Person",
"name": "Roberto Galizi"
},
{
"@type": "Person",
"name": "Nace Kranjc"
},
{
"@type": "Person",
"name": "Austin Burt"
},
{
"@type": "Person",
"name": "Andrea K Beaghton"
},
{
"@type": "Person",
"name": "Tony Nolan"
},
{
"@type": "Person",
"name": "Andrea Crisanti"
}
],
"identifier": "10.1038/nbt.4245"
}
},
{
"@context": "https://schema.org",
"@type": "BreadcrumbList",
"itemListElement": [
{
"@type": "ListItem",
"position": 1,
"name": "Experiments",
"item": "https://replicatescience.com/experiments"
},
{
"@type": "ListItem",
"position": 2,
"name": "A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes methods",
"item": "https://replicatescience.com/experiments/a-crispr-8211-cas9-gene-drive-targeting-doublesex-causes-complete-population-suppression-in-caged-anopheles-gambiae-mosquitoes-methods-kyros-kyrou-pmc6871539/a-crispr-cas9-gene-drive-targeting-doublesex-causes-complete-population-suppression-in-caged-anophel-mlph7bz2"
}
]
}
]