Breaking immune tolerance by targeting Foxp3 + regulatory T cells mitigates Alzheimer's disease pathology methods
Aim. Evidence-backed execution summary for Breaking immune tolerance by targeting Foxp3 + regulatory T cells mitigates Alzheimer's disease pathology methods from Breaking immune tolerance by targeting Foxp3 + regulatory T cells mitigates Alzheimer's disease pathology.
Show snapshot details
On this page
This experiment, in seven questions
Jump straight to the part of the recipe you need. Data and provenance labels stay close to the action they support.
Shopping and prep list
What do I need before I start?
mouse
Subject model for the experiment.
- Use
- confirm full cohort details in the source paper
Immunohistochemistry
reagent used in the protocol.
- Use
- Tissue processing and immunohistochemistry were performed on paraffin-embedded sectioned mouse (6-µm thick) and human (10-µm thick) brains. For human ICAM-1 staining, primary mouse anti-ICAM (1:20 Abcam; ab2213) antibody was used. Slides were incubated for 10 min with 3% H 2 O 2, and a secondary bio...
P300 inhibitor administration
reagent used in the protocol.
- Use
- Inhibition of p300 in mice was performed similar to a previously described protocol. p300i (C646; Tocris Bioscience) was dissolved in DMSO and injected i.p. daily (8.9 mg kg -1 per day, i.p.) for 1 week. Vehicle-treated mice were similarly injected with DMSO.
Activation of the CP in AD-Tg mice by immunomodulation
reagent used in the protocol.
- Use
- We next-tested whether the immunomodulatory compound, glatiramer acetate (GA; also known as Copolymer-1 or Copaxone), which was found in a weekly administration regimen to have a therapeutic effect in the APP/PS1 mouse model of AD, associated with mo-MΦ recruitment to cerebral sites of disease pathology, woul...
Disease attenuation by interfering with Foxp3 + Treg activity
reagent used in the protocol.
- Use
- The findings above, which suggested that Treg-mediated systemic immune suppression interferes with the ability to fight AD pathology, are reminiscent of the function attributed to Tregs in cancer immunology, in which these cells hinder the ability of the immune system to mount an effective anti-tumour response. We...
RNA purification and RT-qPCR analysis
reagent used in the protocol.
- Use
- Total RNA of the hippocampal DG was extracted with TRI Reagent (Molecular Research Center) and purified from the lysates using an RNeasy Kit (Qiagen). Total RNA of the CP was extracted using an RNA MicroPrep Kit (Zymo Research). mRNA (1 µg) was converted into complementary DNA (cDNA) using a High Capacity...
In vitro experiments
reagent used in the protocol.
- Use
- Following intracardial perfusion with PBS, the CPs were removed from the third, fourth, and lateral ventricles, under a dissecting microscope (Stemi DV4), and placed in tubes containing 0.25% trypsin (Life Technologies #15090-046). Tubes were shaken for 20 min at 37 °C, and the tissues were dissocia...
Flow cytometry sample preparation and analysis
reagent used in the protocol.
- Use
- Mice were transcardially perfused with PBS, and tissues were treated as previously described. Brains were dissected, and the different brain regions were removed under a dissecting microscope (Stemi DV4) in PBS, and tissues were dissociated using the gentleMACS dissociator (Miltenyi Biotec). CP tissues were isolate...
sAβ protein isolation and quantification
reagent used in the protocol.
- Use
- Tissue homogenization and sAβ protein extraction was performed as previously described. Briefly, cerebral brain parenchyma was dissected, snap-frozen and kept at -80 °C until homogenization. Proteins were sequentially extracted from samples to obtain separate fractions containing proteins of d...
Immunohistochemistry
Tissue processing and immunohistochemistry were performed on paraffin-embedded sectioned mouse (6-µm thick) and human (10-µm thick) brains. For human ICAM-1 staining, primary mouse anti-ICAM (1:20 Abcam; ab2213) antibody was used. Slides were incubated for 10 min with 3% H 2 O 2, and a secondary bio...
- Use
- Tissue processing and immunohistochemistry were performed on paraffin-embedded sectioned mouse (6-µm thick) and human (10-µm thick) brains. For human ICAM-1 staining, primary mouse anti-ICAM (1:20 Abcam; ab2213) antibody was used. Slides were incubated for 10 min with 3% H 2 O 2, and a secondary bio...
Conditional ablation of Treg
DTx (8 ng g -1 body weight; Sigma) was injected i.p. daily for 4 consecutive days to Foxp3.LuciDTR mice. The efficiency of DTx was confirmed by flow cytometry analysis of immune cells in the blood and spleen, achieving almost complete (>99%) depletion of the GFP-expressing FoxP3 + CD4 + Treg cells...
- Use
- DTx (8 ng g -1 body weight; Sigma) was injected i.p. daily for 4 consecutive days to Foxp3.LuciDTR mice. The efficiency of DTx was confirmed by flow cytometry analysis of immune cells in the blood and spleen, achieving almost complete (>99%) depletion of the GFP-expressing FoxP3 + CD4 + Treg cells...
Transient depletion of Foxp3 + Tregs mitigates AD pathology
To examine how activation of this immune-brain axis affected disease pathology, we examined AD-Tg mice 3 weeks following the Treg depletion, to allow detection of the consequent effect of CP activation for leukocyte trafficking to the CNS. We observed immune cell accumulation in the brain, including elevated numbers...
- Use
- To examine how activation of this immune-brain axis affected disease pathology, we examined AD-Tg mice 3 weeks following the Treg depletion, to allow detection of the consequent effect of CP activation for leukocyte trafficking to the CNS. We observed immune cell accumulation in the brain, including elevated numbers...
Transient depletion of Foxp3 + Tregs mitigates AD pathology
We next evaluated whether the transient depletion of Tregs in AD-Tg mice, which resulted in accumulation of immunoregulatory cells in the brain parenchyma, led to an effect on the local neuroinflammatory response, plaque pathology and cognitive function. Examining the hippocampal cytokine milieu by RT-qPCR, revealed...
- Use
- We next evaluated whether the transient depletion of Tregs in AD-Tg mice, which resulted in accumulation of immunoregulatory cells in the brain parenchyma, led to an effect on the local neuroinflammatory response, plaque pathology and cognitive function. Examining the hippocampal cytokine milieu by RT-qPCR, revealed...
Activation of the CP in AD-Tg mice by immunomodulation
We next-tested whether the immunomodulatory compound, glatiramer acetate (GA; also known as Copolymer-1 or Copaxone), which was found in a weekly administration regimen to have a therapeutic effect in the APP/PS1 mouse model of AD, associated with mo-MΦ recruitment to cerebral sites of disease pathology, woul...
- Use
- We next-tested whether the immunomodulatory compound, glatiramer acetate (GA; also known as Copolymer-1 or Copaxone), which was found in a weekly administration regimen to have a therapeutic effect in the APP/PS1 mouse model of AD, associated with mo-MΦ recruitment to cerebral sites of disease pathology, woul...
Activation of the CP in AD-Tg mice by immunomodulation
To detect infiltrating mo-MΦ entry to the CNS, we used 5XFAD AD-Tg/CX 3 CR1 GFP/+ bone marrow (BM) chimeric mice (prepared using head protection; see Methods), allowing the visualization of circulating (green fluorescent protein (GFP) + labelled) myeloid cells. We found increased homing of GFP + mo-MΦ to...
- Use
- To detect infiltrating mo-MΦ entry to the CNS, we used 5XFAD AD-Tg/CX 3 CR1 GFP/+ bone marrow (BM) chimeric mice (prepared using head protection; see Methods), allowing the visualization of circulating (green fluorescent protein (GFP) + labelled) myeloid cells. We found increased homing of GFP + mo-MΦ to...
Activation of the CP in AD-Tg mice by immunomodulation
Daily injections of GA, both in the clinic for treating relapsing-remitting multiple sclerosis and in animal studies induce Treg-based peripheral immune suppression. Given our present findings of the negative effect of systemic Tregs on AD pathology, and reduced systemic Treg levels following a weekly administratio...
- Use
- Daily injections of GA, both in the clinic for treating relapsing-remitting multiple sclerosis and in animal studies induce Treg-based peripheral immune suppression. Given our present findings of the negative effect of systemic Tregs on AD pathology, and reduced systemic Treg levels following a weekly administratio...
Disease attenuation by interfering with Foxp3 + Treg activity
The findings above, which suggested that Treg-mediated systemic immune suppression interferes with the ability to fight AD pathology, are reminiscent of the function attributed to Tregs in cancer immunology, in which these cells hinder the ability of the immune system to mount an effective anti-tumour response. We...
- Use
- The findings above, which suggested that Treg-mediated systemic immune suppression interferes with the ability to fight AD pathology, are reminiscent of the function attributed to Tregs in cancer immunology, in which these cells hinder the ability of the immune system to mount an effective anti-tumour response. We...
Statistical analysis
Software used for acquisition, scoring, statistics, or reporting.
- Use
- The specific tests used to analyse each set of experiments are indicated in the figure legends. Data were analysed using a two-tailed Student's t -test to compare between two groups, one-way ANOVA was used to compare several groups, followed by the Newman-Keuls post hoc procedure for pairwise comparison of gro...
Before you run
What should be confirmed before execution?
First confirmation
Equipment is listed but no product mappings are linked.
Confirm before execution
This page is backed by a publishable Replication Data Ledger package with zero critical source-verification issues.
Confirm before execution
Open the source paper before finalizing run-specific details.
Procurement checkpoint
Use source-stated vendors where present. Treat mapped products as sourcing options unless the page marks an exact source match.
Open quote workflowStep-by-step procedure
What do I do, in order?
Immunohistochemistry
Tissue processing and immunohistochemistry were performed on paraffin-embedded sectioned mouse (6-µm thick) and human (10-µm thick) brains. For human ICAM-1 staining, primary mouse anti-ICAM (1:20 Abcam; ab2213) antibody was used. Slides were incubated for 10 min with 3% H 2 O 2, and a secondary biotin-conjugated anti-mouse antibody was used, followed by biotin/avidin amplification with Vectastain ABC kit (Vector Laboratories). Subsequently, DAB (3,3′-diaminobenzidine substrate) (Zytomed kit) was applied; slides were dehydrated and mounted with xylene-based mounting solution. For tissue staining, mice were transcardially perfused with PBS prior to tissue excision and fixation. CP tissues were isolated under a dissecting microscope (Stemi DV4; Zeiss) from the lateral, third and fourth ventricles of the brain. For whole mount CP staining, tissues were fixed with 2...
GA administration
Each mouse was s.c. injected with a total dose of 100 µg of GA (batch no. P53640; Teva Pharmaceutical Industries, Petah Tiqva, Israel) dissolved in 200 µl of PBS. Mice were either injected according to a weekly GA regimen ( ) or daily-GA administration ( ). Mice were killed either 1 week after the last GA injection, or 1 month after treatment, as indicated for each experiment.
P300 inhibitor administration
Inhibition of p300 in mice was performed similar to a previously described protocol. p300i (C646; Tocris Bioscience) was dissolved in DMSO and injected i.p. daily (8.9 mg kg -1 per day, i.p.) for 1 week. Vehicle-treated mice were similarly injected with DMSO.
ATRA treatment
ATRA administration to mice was performed similar to a previously described protocol. ATRA (Sigma) was dissolved in DMSO and injected i.p. (8 mg kg -1 per day) every other day over the course of 1 week. Vehicle-treated mice were similarly injected with DMSO.
Transient depletion of Foxp3 + Tregs mitigates AD pathology
To examine how activation of this immune-brain axis affected disease pathology, we examined AD-Tg mice 3 weeks following the Treg depletion, to allow detection of the consequent effect of CP activation for leukocyte trafficking to the CNS. We observed immune cell accumulation in the brain, including elevated numbers of CD45 high /CD11b high myeloid cells, representing infiltrating mo-MΦ and CD4 + T cells (; ). In addition, brief and transient depletion of Tregs resulted in a marked enrichment of Foxp3 + Tregs among the CD4 + T cells that accumulated within the brain, as assessed by flow cytometry ( ). RT-qPCR analysis of the hippocampus showed increased expression of foxp3 and il10 mRNA levels ( ), and immunohistochemical analysis revealed T cells adjacent to Aβ plaques ( ); among these were IL-10- and Foxp3-expressing cells ( ). Thus, transiently breaking Treg-mediated sys...
Activation of the CP in AD-Tg mice by immunomodulation
We next-tested whether the immunomodulatory compound, glatiramer acetate (GA; also known as Copolymer-1 or Copaxone), which was found in a weekly administration regimen to have a therapeutic effect in the APP/PS1 mouse model of AD, associated with mo-MΦ recruitment to cerebral sites of disease pathology, would induce CP activation to enhance leukocyte trafficking. We found that the CP in APP/PS1 AD-Tg mice expresses lower levels of IFN-γ relative to age-matched WT controls ( ), similarly to our observation in the 5XFAD AD-Tg mouse model ( ). These findings encouraged us to test whether the observed therapeutic effect of weekly administration of GA in APP/PS1 mice could be reproduced in 5XFAD AD-Tg mice, and if so, whether it would involve an effect on systemic Tregs and IFN-γ-activation of the CP for mo-MΦ trafficking. We therefore treated 5XFAD AD-Tg mice with a...
Activation of the CP in AD-Tg mice by immunomodulation
Daily injections of GA, both in the clinic for treating relapsing-remitting multiple sclerosis and in animal studies induce Treg-based peripheral immune suppression. Given our present findings of the negative effect of systemic Tregs on AD pathology, and reduced systemic Treg levels following a weekly administration regimen of GA, we envisioned that comparing the effect of GA in these two administration regimens (weekly versus daily) might further contribute to the understanding of the inverse relationship between systemic Tregs and AD progression. We therefore compared the effect of daily- versus weekly-GA administration over a period of 4 weeks (schematically depicted in ), on disease pathology in 5XFAD AD-Tg mice. Assessment of cognitive performance by the radial-arm water maze (RAWM) task revealed that, in contrast to the beneficial effect of weekly GA treatment over a period of...
Disease attenuation by interfering with Foxp3 + Treg activity
The findings above, which suggested that Treg-mediated systemic immune suppression interferes with the ability to fight AD pathology, are reminiscent of the function attributed to Tregs in cancer immunology, in which these cells hinder the ability of the immune system to mount an effective anti-tumour response. We therefore tested p300i (C646), a nonpeptidic inhibitor of the histone acetyltransferase p300 (ref. ); although histone acetyltransferases can have a direct effect on the brain, p300i was found to regulate T-cell function by impairing Treg suppressive activities without affecting effector T-cell protective responses. We found that mice treated with p300i, compared with vehicle (dimethylsulphoxide (DMSO))-treated controls, showed elevated levels of systemic IFN-γ-expressing cells in the spleen ( ), as well as in the CP ( ). We next treated AD-Tg mice at the age of 10 m...
Measurement outputs
What raw and processed outputs should exist?
Tnf-α: forward 5′- GCCTCTTCTCATTCCTGCTT -3′ reverse CTCCTCCACTTGGTGGTTTG -3′;
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
Il-1β: forward 5′- CCAAAAGATGAAGGGCTGCTT -3′ and reverse 5′- TGCTGCTGCGAGATTTGAAG -3′;
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
Il-12 p40: forward 5′- GAAGTTCAACATCAAGAGCA -3′ and reverse 5′- CATAGTCCCTTTGGTCCAG -3′;
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
Il-10: forward 5′- TGAATTCCCTGGGTGAGAAGCTGA -3′ and reverse 5′- TGGCCTTGTAGACACCTTGGTCTT -3′;
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
Analysis plan
How should the outputs become interpretable results?
Acquisition
Collect raw experimental outputs with enough metadata to preserve sample identity, condition, and timing.
inferred from protocolPreprocessing / cleaning
We next evaluated whether the transient depletion of Tregs in AD-Tg mice, which resulted in accumulation of immunoregulatory cells in the brain parenchyma, led to an effect on the local neuroinflammatory response, plaque pathology and cognitive function.
from paperScoring or quantification
Quantify the primary readouts for this experiment: Tnf-α: forward 5′- GCCTCTTCTCATTCCTGCTT -3′ reverse CTCCTCCACTTGGTGGTTTG -3′;; Il-1β: forward 5′- CCAAAAGATGAAGGGCTGCTT -3′ and reverse 5′- TGCTGCTGCGAGATTTGAAG -3′;; Il-12 p40: forward 5′- GAAGTTCAACATCAAGAGCA -3′ and reverse 5′- CATAGTCCCTTTGGTCCAG -3′;; Il-10: forward 5′- TGAATTCCCTGGGTGAGAAGCTGA -3′ and reverse 5′- TGGCCTTGTAGACACCTTGGTCTT -3′;.
from paperStatistical comparison
We next evaluated whether the transient depletion of Tregs in AD-Tg mice, which resulted in accumulation of immunoregulatory cells in the brain parenchyma, led to an effect on t...; The findings above, which suggested that Treg-mediated systemic immune suppression interferes with the ability to fight AD pathology, are reminiscent of the function attributed...; Mice were given three trials per day, for 4 consecutive days, to learn to find a hidden platform located 1.5 cm below the water surface in a pool (1.1 m in diameter)...; The specific tests used to analyse each set of experiments are indicated in the figure legends. Data were analysed using a two-tailed Student's t -test to compare between two gr...
from paperReporting output
Report representative outputs alongside summary comparisons for Tnf-α: forward 5′- GCCTCTTCTCATTCCTGCTT -3′ reverse CTCCTCCACTTGGTGGTTTG -3′;, Il-1β: forward 5′- CCAAAAGATGAAGGGCTGCTT -3′ and reverse 5′- TGCTGCTGCGAGATTTGAAG -3′;, Il-12 p40: forward 5′- GAAGTTCAACATCAAGAGCA -3′ and reverse 5′- CATAGTCCCTTTGGTCCAG -3′;, Il-10: forward 5′- TGAATTCCCTGGGTGAGAAGCTGA -3′ and reverse 5′- TGGCCTTGTAGACACCTTGGTCTT -3′;.
inferred from protocolStructured statistical methods
We next evaluated whether the transient depletion of Tregs in AD-Tg mice, which resulted in accumulation of immunoregulatory cells in the brain parenchyma, led to an effect on t...; The findings above, which suggested that Treg-mediated systemic immune suppression interferes with the ability to fight AD pathology, are reminiscent of the function attributed...; Mice were given three trials per day, for 4 consecutive days, to learn to find a hidden platform located 1.5 cm below the water surface in a pool (1.1 m in diameter)...; The specific tests used to analyse each set of experiments are indicated in the figure legends. Data were analysed using a two-tailed Student's t -test to compare between two gr...
source structuredSource and audit
What supports the facts on this page?
Evidence quotes (8)
Tissue processing and immunohistochemistry were performed on paraffin-embedded sectioned mouse (6-µm thick) and human (10-µm thick) brains. For human ICAM-1 staining, primary mouse anti-ICAM (1:20 Abcam; ab2213) antibody was used. Slides were incubated for 10 min with 3% H 2 O 2, and a secondary biotin-conjugated anti-mouse antibody was used, followed by biotin/avidin amplification with Vectastain ABC kit (Vector Laboratories). Subsequently, DAB (3,3′-diaminobenzidine substrate) (Zytomed kit) was applied; slides were dehydrated and mounted with xylene-based mounting solution. For tissue staining, mice were transcardially perfused with PBS prior to tissue excision and fixation. CP tissues were isolated under a dissecting microscope (Stemi DV4; Zeiss) from the lateral, third and fourth ventricles of the brain. For whole mount CP staining, tissues were fixed with 2.5% paraformaldehyde for 1 h at 4 °C, and subsequently transferred to PBS containing 0.05% sodium azide. Prior to staining, the dissected tissues were washed with PBS and blocked (20% horse serum, 0.3% Triton X-100 and PBS) for 1 h at room temperature. Whole mount staining wit...
Each mouse was s.c. injected with a total dose of 100 µg of GA (batch no. P53640; Teva Pharmaceutical Industries, Petah Tiqva, Israel) dissolved in 200 µl of PBS. Mice were either injected according to a weekly GA regimen ( ) or daily-GA administration ( ). Mice were killed either 1 week after the last GA injection, or 1 month after treatment, as indicated for each experiment.
Inhibition of p300 in mice was performed similar to a previously described protocol. p300i (C646; Tocris Bioscience) was dissolved in DMSO and injected i.p. daily (8.9 mg kg -1 per day, i.p.) for 1 week. Vehicle-treated mice were similarly injected with DMSO.
ATRA administration to mice was performed similar to a previously described protocol. ATRA (Sigma) was dissolved in DMSO and injected i.p. (8 mg kg -1 per day) every other day over the course of 1 week. Vehicle-treated mice were similarly injected with DMSO.
To examine how activation of this immune-brain axis affected disease pathology, we examined AD-Tg mice 3 weeks following the Treg depletion, to allow detection of the consequent effect of CP activation for leukocyte trafficking to the CNS. We observed immune cell accumulation in the brain, including elevated numbers of CD45 high /CD11b high myeloid cells, representing infiltrating mo-MΦ and CD4 + T cells (; ). In addition, brief and transient depletion of Tregs resulted in a marked enrichment of Foxp3 + Tregs among the CD4 + T cells that accumulated within the brain, as assessed by flow cytometry ( ). RT-qPCR analysis of the hippocampus showed increased expression of foxp3 and il10 mRNA levels ( ), and immunohistochemical analysis revealed T cells adjacent to Aβ plaques ( ); among these were IL-10- and Foxp3-expressing cells ( ). Thus, transiently breaking Treg-mediated systemic immune suppression in AD-Tg mice, augmented the recruitment of inflammation-resolving immune cells, including mo-MΦ and Tregs, to cerebral sites of Aβ pathology.
We next-tested whether the immunomodulatory compound, glatiramer acetate (GA; also known as Copolymer-1 or Copaxone), which was found in a weekly administration regimen to have a therapeutic effect in the APP/PS1 mouse model of AD, associated with mo-MΦ recruitment to cerebral sites of disease pathology, would induce CP activation to enhance leukocyte trafficking. We found that the CP in APP/PS1 AD-Tg mice expresses lower levels of IFN-γ relative to age-matched WT controls ( ), similarly to our observation in the 5XFAD AD-Tg mouse model ( ). These findings encouraged us to test whether the observed therapeutic effect of weekly administration of GA in APP/PS1 mice could be reproduced in 5XFAD AD-Tg mice, and if so, whether it would involve an effect on systemic Tregs and IFN-γ-activation of the CP for mo-MΦ trafficking. We therefore treated 5XFAD AD-Tg mice with a weekly administration regimen of GA over a period of 4 weeks (henceforth, 'weekly GA'; schematically depicted in ). We found that 5XFAD AD-Tg mice treated with weekly GA showed reduced neuroinflammation ( ), enhanced hippocampal expression of brain-derived neurotrophic factor ( bdnf ) and ins...
Daily injections of GA, both in the clinic for treating relapsing-remitting multiple sclerosis and in animal studies induce Treg-based peripheral immune suppression. Given our present findings of the negative effect of systemic Tregs on AD pathology, and reduced systemic Treg levels following a weekly administration regimen of GA, we envisioned that comparing the effect of GA in these two administration regimens (weekly versus daily) might further contribute to the understanding of the inverse relationship between systemic Tregs and AD progression. We therefore compared the effect of daily- versus weekly-GA administration over a period of 4 weeks (schematically depicted in ), on disease pathology in 5XFAD AD-Tg mice. Assessment of cognitive performance by the radial-arm water maze (RAWM) task revealed that, in contrast to the beneficial effect of weekly GA treatment over a period of 4 weeks, either no beneficial effect on spatial memory or a tendency towards a worsening effect was observed in AD-Tg mice that received daily-GA ( ). In addition, unlike the robust effect of the weekly GA administration on plaque clearance, daily-GA-treated AD-Tg mice did not show any beneficial ef...
The findings above, which suggested that Treg-mediated systemic immune suppression interferes with the ability to fight AD pathology, are reminiscent of the function attributed to Tregs in cancer immunology, in which these cells hinder the ability of the immune system to mount an effective anti-tumour response. We therefore tested p300i (C646), a nonpeptidic inhibitor of the histone acetyltransferase p300 (ref. ); although histone acetyltransferases can have a direct effect on the brain, p300i was found to regulate T-cell function by impairing Treg suppressive activities without affecting effector T-cell protective responses. We found that mice treated with p300i, compared with vehicle (dimethylsulphoxide (DMSO))-treated controls, showed elevated levels of systemic IFN-γ-expressing cells in the spleen ( ), as well as in the CP ( ). We next treated AD-Tg mice at the age of 10 months (a stage of robust cerebral plaque pathology) with p300i over a course of 1 week, and examined the mice 3 weeks later for cerebral Aβ plaque burden. Immunohistochemical analysis revealed a significant reduction in cerebral Aβ plaque load in the p300i-treated AD-Tg mice relative to ve...
Machine-readable layer
[
{
"@context": "https://schema.org",
"@type": "HowTo",
"name": "Breaking immune tolerance by targeting Foxp3 + regulatory T cells mitigates Alzheimer's disease pathology methods",
"description": "Evidence-backed execution summary for Breaking immune tolerance by targeting Foxp3 + regulatory T cells mitigates Alzheimer's disease pathology methods from Breaking immune tolerance by targeting Foxp3 + regulatory T cells mitigates Alzheimer's disease pathology.",
"totalTime": "PT36000M",
"step": [
{
"@type": "HowToStep",
"position": 1,
"name": "Immunohistochemistry",
"text": "Tissue processing and immunohistochemistry were performed on paraffin-embedded sectioned mouse (6-µm thick) and human (10-µm thick) brains. For human ICAM-1 staining, primary mouse anti-ICAM (1:20 Abcam; ab2213) antibody was used. Slides were incubated for 10 min with 3% H 2 O 2, and a secondary biotin-conjugated anti-mouse antibody was used, followed by biotin/avidin amplification with Vectastain ABC kit (Vector Laboratories). Subsequently, DAB (3,3′-diaminobenzidine substrate) (Zytomed kit) was applied; slides were dehydrated and mounted with xylene-based mounting solution. For tissue staining, mice were transcardially perfused with PBS prior to tissue excision and fixation. CP tissues were isolated under a dissecting microscope (Stemi DV4; Zeiss) from the lateral, third and fourth ventricles of the brain. For whole mount CP staining, tissues were fixed with 2..."
},
{
"@type": "HowToStep",
"position": 2,
"name": "GA administration",
"text": "Each mouse was s.c. injected with a total dose of 100 µg of GA (batch no. P53640; Teva Pharmaceutical Industries, Petah Tiqva, Israel) dissolved in 200 µl of PBS. Mice were either injected according to a weekly GA regimen ( ) or daily-GA administration ( ). Mice were killed either 1 week after the last GA injection, or 1 month after treatment, as indicated for each experiment."
},
{
"@type": "HowToStep",
"position": 3,
"name": "P300 inhibitor administration",
"text": "Inhibition of p300 in mice was performed similar to a previously described protocol. p300i (C646; Tocris Bioscience) was dissolved in DMSO and injected i.p. daily (8.9 mg kg -1 per day, i.p.) for 1 week. Vehicle-treated mice were similarly injected with DMSO."
},
{
"@type": "HowToStep",
"position": 4,
"name": "ATRA treatment",
"text": "ATRA administration to mice was performed similar to a previously described protocol. ATRA (Sigma) was dissolved in DMSO and injected i.p. (8 mg kg -1 per day) every other day over the course of 1 week. Vehicle-treated mice were similarly injected with DMSO."
},
{
"@type": "HowToStep",
"position": 5,
"name": "Transient depletion of Foxp3 + Tregs mitigates AD pathology",
"text": "To examine how activation of this immune-brain axis affected disease pathology, we examined AD-Tg mice 3 weeks following the Treg depletion, to allow detection of the consequent effect of CP activation for leukocyte trafficking to the CNS. We observed immune cell accumulation in the brain, including elevated numbers of CD45 high /CD11b high myeloid cells, representing infiltrating mo-MΦ and CD4 + T cells (; ). In addition, brief and transient depletion of Tregs resulted in a marked enrichment of Foxp3 + Tregs among the CD4 + T cells that accumulated within the brain, as assessed by flow cytometry ( ). RT-qPCR analysis of the hippocampus showed increased expression of foxp3 and il10 mRNA levels ( ), and immunohistochemical analysis revealed T cells adjacent to Aβ plaques ( ); among these were IL-10- and Foxp3-expressing cells ( ). Thus, transiently breaking Treg-mediated sys..."
},
{
"@type": "HowToStep",
"position": 6,
"name": "Activation of the CP in AD-Tg mice by immunomodulation",
"text": "We next-tested whether the immunomodulatory compound, glatiramer acetate (GA; also known as Copolymer-1 or Copaxone), which was found in a weekly administration regimen to have a therapeutic effect in the APP/PS1 mouse model of AD, associated with mo-MΦ recruitment to cerebral sites of disease pathology, would induce CP activation to enhance leukocyte trafficking. We found that the CP in APP/PS1 AD-Tg mice expresses lower levels of IFN-γ relative to age-matched WT controls ( ), similarly to our observation in the 5XFAD AD-Tg mouse model ( ). These findings encouraged us to test whether the observed therapeutic effect of weekly administration of GA in APP/PS1 mice could be reproduced in 5XFAD AD-Tg mice, and if so, whether it would involve an effect on systemic Tregs and IFN-γ-activation of the CP for mo-MΦ trafficking. We therefore treated 5XFAD AD-Tg mice with a..."
},
{
"@type": "HowToStep",
"position": 7,
"name": "Activation of the CP in AD-Tg mice by immunomodulation",
"text": "Daily injections of GA, both in the clinic for treating relapsing-remitting multiple sclerosis and in animal studies induce Treg-based peripheral immune suppression. Given our present findings of the negative effect of systemic Tregs on AD pathology, and reduced systemic Treg levels following a weekly administration regimen of GA, we envisioned that comparing the effect of GA in these two administration regimens (weekly versus daily) might further contribute to the understanding of the inverse relationship between systemic Tregs and AD progression. We therefore compared the effect of daily- versus weekly-GA administration over a period of 4 weeks (schematically depicted in ), on disease pathology in 5XFAD AD-Tg mice. Assessment of cognitive performance by the radial-arm water maze (RAWM) task revealed that, in contrast to the beneficial effect of weekly GA treatment over a period of..."
},
{
"@type": "HowToStep",
"position": 8,
"name": "Disease attenuation by interfering with Foxp3 + Treg activity",
"text": "The findings above, which suggested that Treg-mediated systemic immune suppression interferes with the ability to fight AD pathology, are reminiscent of the function attributed to Tregs in cancer immunology, in which these cells hinder the ability of the immune system to mount an effective anti-tumour response. We therefore tested p300i (C646), a nonpeptidic inhibitor of the histone acetyltransferase p300 (ref. ); although histone acetyltransferases can have a direct effect on the brain, p300i was found to regulate T-cell function by impairing Treg suppressive activities without affecting effector T-cell protective responses. We found that mice treated with p300i, compared with vehicle (dimethylsulphoxide (DMSO))-treated controls, showed elevated levels of systemic IFN-γ-expressing cells in the spleen ( ), as well as in the CP ( ). We next treated AD-Tg mice at the age of 10 m..."
}
],
"tool": [
{
"@type": "HowToTool",
"name": "Immunohistochemistry"
},
{
"@type": "HowToTool",
"name": "Conditional ablation of Treg"
},
{
"@type": "HowToTool",
"name": "Transient depletion of Foxp3 + Tregs mitigates AD pathology"
},
{
"@type": "HowToTool",
"name": "Transient depletion of Foxp3 + Tregs mitigates AD pathology"
},
{
"@type": "HowToTool",
"name": "Activation of the CP in AD-Tg mice by immunomodulation"
},
{
"@type": "HowToTool",
"name": "Activation of the CP in AD-Tg mice by immunomodulation"
},
{
"@type": "HowToTool",
"name": "Activation of the CP in AD-Tg mice by immunomodulation"
},
{
"@type": "HowToTool",
"name": "Disease attenuation by interfering with Foxp3 + Treg activity"
}
],
"supply": [
{
"@type": "HowToSupply",
"name": "Immunohistochemistry"
},
{
"@type": "HowToSupply",
"name": "P300 inhibitor administration"
},
{
"@type": "HowToSupply",
"name": "Activation of the CP in AD-Tg mice by immunomodulation"
},
{
"@type": "HowToSupply",
"name": "Disease attenuation by interfering with Foxp3 + Treg activity"
},
{
"@type": "HowToSupply",
"name": "RNA purification and RT-qPCR analysis"
},
{
"@type": "HowToSupply",
"name": "In vitro experiments"
},
{
"@type": "HowToSupply",
"name": "Flow cytometry sample preparation and analysis"
},
{
"@type": "HowToSupply",
"name": "sAβ protein isolation and quantification"
}
],
"isBasedOn": {
"@type": "ScholarlyArticle",
"headline": "Breaking immune tolerance by targeting Foxp3 + regulatory T cells mitigates Alzheimer's disease pathology",
"datePublished": "2015",
"author": [
{
"@type": "Person",
"name": "Kuti Baruch"
},
{
"@type": "Person",
"name": "Neta Rosenzweig"
},
{
"@type": "Person",
"name": "Alexander Kertser"
},
{
"@type": "Person",
"name": "Aleksandra Deczkowska"
},
{
"@type": "Person",
"name": "Alaa Mohammad Sharif"
},
{
"@type": "Person",
"name": "Amit Spinrad"
},
{
"@type": "Person",
"name": "Afroditi Tsitsou-Kampeli"
},
{
"@type": "Person",
"name": "Ayelet Sarel"
},
{
"@type": "Person",
"name": "Liora Cahalon"
},
{
"@type": "Person",
"name": "Michal Schwartz"
}
],
"identifier": "10.1038/ncomms8967"
}
},
{
"@context": "https://schema.org",
"@type": "BreadcrumbList",
"itemListElement": [
{
"@type": "ListItem",
"position": 1,
"name": "Experiments",
"item": "https://replicatescience.com/experiments"
},
{
"@type": "ListItem",
"position": 2,
"name": "Breaking immune tolerance by targeting Foxp3 + regulatory T cells mitigates Alzheimer's disease pathology methods",
"item": "https://replicatescience.com/experiments/breaking-immune-tolerance-by-targeting-foxp3-regulatory-t-cells-mitigates-alzheimer-s-disease-pathology-methods-kuti-baruch-pmc4557123/breaking-immune-tolerance-by-targeting-foxp3-regulatory-t-cells-mitigates-alzheimer-s-disease-pathol-mlpgur5g"
}
]
}
]