Cytosolic phospholipase A2 in infiltrating monocyte derived macrophages does not impair recovery after spinal cord injury in female mice methods
Aim. Evidence-backed execution summary for Cytosolic phospholipase A2 in infiltrating monocyte derived macrophages does not impair recovery after spinal cord injury in female mice methods from Cytosolic phospholipase A2 in infiltrating monocyte derived macrophages does not impair recovery after spinal cord injury in female mice.
Show snapshot details
On this page
This experiment, in seven questions
Jump straight to the part of the recipe you need. Data and provenance labels stay close to the action they support.
Shopping and prep list
What do I need before I start?
mouse
Subject model for the experiment.
- Use
- confirm full cohort details in the source paper
Cell culture
reagent used in the protocol.
- Use
- Bone marrow-derived macrophages (BMDMs) were extracted from the femur and tibia of cPLA2 KO and WT littermate controls as described previously. BMDMs were plated at 0.8-1 × 10 6 cells/mL in differentiation media containing Roswell Park Memorial Institute medium (RPMI, Thermo Fisher Scientific, #218...
Myelin isolation
reagent used in the protocol.
- Use
- Moderate purity myelin (> 95% myelin, with small contributions from the axolemma and other cellular membranes) was prepared as previously described. Brains were collected from C57BL/6 mice and stored at -80 °C prior to myelin isolation. Brains were first rinsed and suspended in cold PBS with 1% P/S...
Neurotoxicity assay
reagent used in the protocol.
- Use
- To assess the neurotoxicity of stimulated BMDMs, a mouse neuroblastoma cell line (Neuro-2a or N2A, a gift from Chris Richards, University of Kentucky) was maintained in N2A growth medium consisting of 45% DMEM, 45% OPTI-MEM reduced-serum medium, 10% fetal bovine serum (FBS), and 1% penicillin/streptomycin. N2A cells...
Reactive oxygen species assay
reagent used in the protocol.
- Use
- Macrophage reactive oxygen species (ROS) production was measured using chloromethyl 2′,7′-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) (Invitrogen-gen #C6827) as previously described. In short, BMDMs were cultured and stimulated as described above except in a 96-well plate (1 × 10...
Arginase activity assay
reagent used in the protocol.
- Use
- Macrophage arginase activity was measured using the Arginase Activity Assay Kit (ab180877). In short, BMDMs were cultured and stimulated as described above. Following the removal of the supernatant cells were washed 2x in cold PBS, and homogenized in 100 µL cold assay buffer on ice with a pipette. After followi...
Nitric oxide assay
reagent used in the protocol.
- Use
- Macrophage nitric oxide production was measured using the Griess Reagent Kit (G-7921). In short, BMDMs were cultured and stimulated as described above except for a substitution using phenol red-free RPMI, and the stimulations were scaled down to a 96-well plate format (1 × 10 6 cells/mL). Following...
Immunohistochemistry
reagent used in the protocol.
- Use
- At the study endpoint, mice were given a lethal dose of ketamine and xylazine. Blood was then collected by cardiac puncture in a heparinized needle and syringe and transferred to an EDTA-coated tube (VWR, 101094-004) for leukocyte isolation (see below). Mice were transcardially perfused with PBS followed by 4% paraf...
Immunohistochemistry
reagent used in the protocol.
- Use
- To assess lesion volume, all tissue was stained with eriochrome cyanine and neurofilament heavy, which stain intact myelin and axons, respectively. These markers were used to distinguish lesioned from intact tissue. To stain for neurofilament, sections underwent antigen retrieval in citrate buffer (pH 6.0) at 80...
Materials and methods
Behavioral analysis of locomotor recovery: BMS, Horizontal Ladder, Catwalk gait analysis
- Use
- Behavioral analysis of locomotor recovery: BMS, Horizontal Ladder, Catwalk gait analysis
Cell culture
Bone marrow-derived macrophages (BMDMs) were extracted from the femur and tibia of cPLA2 KO and WT littermate controls as described previously. BMDMs were plated at 0.8-1 × 10 6 cells/mL in differentiation media containing Roswell Park Memorial Institute medium (RPMI, Thermo Fisher Scientific, #218...
- Use
- Bone marrow-derived macrophages (BMDMs) were extracted from the femur and tibia of cPLA2 KO and WT littermate controls as described previously. BMDMs were plated at 0.8-1 × 10 6 cells/mL in differentiation media containing Roswell Park Memorial Institute medium (RPMI, Thermo Fisher Scientific, #218...
Neurotoxicity assay
To assess the neurotoxicity of stimulated BMDMs, a mouse neuroblastoma cell line (Neuro-2a or N2A, a gift from Chris Richards, University of Kentucky) was maintained in N2A growth medium consisting of 45% DMEM, 45% OPTI-MEM reduced-serum medium, 10% fetal bovine serum (FBS), and 1% penicillin/streptomycin. N2A cells...
- Use
- To assess the neurotoxicity of stimulated BMDMs, a mouse neuroblastoma cell line (Neuro-2a or N2A, a gift from Chris Richards, University of Kentucky) was maintained in N2A growth medium consisting of 45% DMEM, 45% OPTI-MEM reduced-serum medium, 10% fetal bovine serum (FBS), and 1% penicillin/streptomycin. N2A cells...
Reactive oxygen species assay
Macrophage reactive oxygen species (ROS) production was measured using chloromethyl 2′,7′-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) (Invitrogen-gen #C6827) as previously described. In short, BMDMs were cultured and stimulated as described above except in a 96-well plate (1 × 10...
- Use
- Macrophage reactive oxygen species (ROS) production was measured using chloromethyl 2′,7′-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) (Invitrogen-gen #C6827) as previously described. In short, BMDMs were cultured and stimulated as described above except in a 96-well plate (1 × 10...
Arginase activity assay
Macrophage arginase activity was measured using the Arginase Activity Assay Kit (ab180877). In short, BMDMs were cultured and stimulated as described above. Following the removal of the supernatant cells were washed 2x in cold PBS, and homogenized in 100 µL cold assay buffer on ice with a pipette. After followi...
- Use
- Macrophage arginase activity was measured using the Arginase Activity Assay Kit (ab180877). In short, BMDMs were cultured and stimulated as described above. Following the removal of the supernatant cells were washed 2x in cold PBS, and homogenized in 100 µL cold assay buffer on ice with a pipette. After followi...
Hematopoietic stem cell transplantation
To reduce the nonspecific effects of irradiation on the spinal cord, a preliminary dosing study was performed. Wild-type C57BL6 mice were exposed to a split dose of 8, 10.5, or 13 Gy of radiation from a Cesium-137 radioactive core. The two half doses were separated by 3 h. Hematopoietic stem cells (HSCs) w...
- Use
- To reduce the nonspecific effects of irradiation on the spinal cord, a preliminary dosing study was performed. Wild-type C57BL6 mice were exposed to a split dose of 8, 10.5, or 13 Gy of radiation from a Cesium-137 radioactive core. The two half doses were separated by 3 h. Hematopoietic stem cells (HSCs) w...
Behavioral assessment of locomotor recovery
Locomotor recovery was assessed after SCI with the Basso Mouse Scale (BMS) open field test, CatWalk XT gait analysis system, and the horizontal ladder test. The BMS utilizes a 9-point rating scale to characterize gross locomotor functions ranging from complete paralysis (score 0) to normal functions (score 9) as mic...
- Use
- Locomotor recovery was assessed after SCI with the Basso Mouse Scale (BMS) open field test, CatWalk XT gait analysis system, and the horizontal ladder test. The BMS utilizes a 9-point rating scale to characterize gross locomotor functions ranging from complete paralysis (score 0) to normal functions (score 9) as mic...
Behavioral assessment of locomotor recovery
We also used the CatWalk XT gait analysis system (Noldus, Wageningen, the Netherlands) to track specific parameters of gait. For CatWalk analysis, mice underwent three testing sessions: one week before injury and 4- and 6-weeks post-injury. The CatWalk features a red overhead light and green illuminated walkway, whi...
- Use
- We also used the CatWalk XT gait analysis system (Noldus, Wageningen, the Netherlands) to track specific parameters of gait. For CatWalk analysis, mice underwent three testing sessions: one week before injury and 4- and 6-weeks post-injury. The CatWalk features a red overhead light and green illuminated walkway, whi...
Statistics
Software used for acquisition, scoring, statistics, or reporting.
- Use
- All statistical tests were performed using GraphPad Prism software (v9.4.1, Boston, MA). All in vitro data were analyzed using an ordinary one-way ANOVA followed by Tukey's multiple comparisons test. An unpaired Student's t test was used to compare cPLA2 expression between cPLA2 KO and WT chimeras. For b...
Before you run
What should be confirmed before execution?
First confirmation
Equipment is listed but no product mappings are linked.
Confirm before execution
This page is backed by a publishable Replication Data Ledger package with zero critical source-verification issues.
Confirm before execution
Open the source paper before finalizing run-specific details.
Procurement checkpoint
Use source-stated vendors where present. Treat mapped products as sourcing options unless the page marks an exact source match.
Open quote workflowStep-by-step procedure
What do I do, in order?
Materials and methods
In these experiments, 2- to 4-month-old female cPLA2 -/- (cPLA2 KO), cPLA2 +/+ (WT) littermate controls, and Actin-GFP C57BL/6 mice were used as hematopoietic stem cell transplant (HSCT) donors. Three-month-old C57BL/6 mice (Jackson Labs, Bar Harbor, Maine) were used as HSCT recipients. cPLA2 KO mice were previously generated, and breeding pairs were generously donated by Dr. Xiao-Ming Xu at the Indiana University School of Medicine and endorsed by Dr. Joseph Bonventre (Harvard University). To reduce the risk of bone marrow rejection or related pathologies (graft versus host disease), cPLA2 KO mice were backcrossed to C57BL/6J females acquired from Jackson Labs. Actin-GFP mice were originally purchased from Jackson Labs but were generously donated by Dr. Ahmed Abdel-Latif at the University of Kentucky. All animals were housed in IVC cages with ad libitum access to food an...
Cell culture
Bone marrow-derived macrophages (BMDMs) were extracted from the femur and tibia of cPLA2 KO and WT littermate controls as described previously. BMDMs were plated at 0.8-1 × 10 6 cells/mL in differentiation media containing Roswell Park Memorial Institute medium (RPMI, Thermo Fisher Scientific, #21870-092) supplemented with 1% pen/strep (P/S, Thermo Fisher Scientific, #5140122), 1% HEPES (Sigma-Aldrich, #83264-100ML-F), 1% GlutaMAX 0.001 (Thermo Fisher Scientific, #35050061), 0.001% β-mercaptoethanol (Thermo Fisher Scientific, #21985023), 10% FBS (Life Technologies, #10082147), and 20% supernatant from sL929 cells (a generous gift from Phillip Popovich, The Ohio State University). Supernatant collected from sL929 cells contains macrophage colony-stimulating factor, which helps to promote bone marrow cell differentiation into macrophages. After 7 days of di...
Myelin isolation
Moderate purity myelin (> 95% myelin, with small contributions from the axolemma and other cellular membranes) was prepared as previously described. Brains were collected from C57BL/6 mice and stored at -80 °C prior to myelin isolation. Brains were first rinsed and suspended in cold PBS with 1% P/S (PBS/P/S) and homogenized with the loose and tight pestles of a Dounce homogenizer (DWK Life Science, #357544). The resulting suspension was transferred to a 15 mL tube and pelleted at 447 g prior to discarding the supernatant. The pellet was resuspended in PBS/P/S, and then 5 mL of a 30% Percoll solution (Sigma-Aldrich, #P1644-500ML) was gently dispensed below the myelin solution to perform density-graded centrifugation. The layers were then centrifuged at 447 g for 15 min at 4 °C under gentle acceleration/deceleration. This generated three d...
Hematopoietic stem cell transplantation
To reduce the nonspecific effects of irradiation on the spinal cord, a preliminary dosing study was performed. Wild-type C57BL6 mice were exposed to a split dose of 8, 10.5, or 13 Gy of radiation from a Cesium-137 radioactive core. The two half doses were separated by 3 h. Hematopoietic stem cells (HSCs) were isolated from Actin-GFP donors, and 1 × 10 6 HSCs were administered by retro-orbital injection into recipients one hour after the last dose of radiation. Mice were maintained on water supplemented with antibiotics (40 mg sulfamethoxazole/8 mg trimethoprim per 100 ml water) (Bactrim) for one week prior to and 4 weeks after irradiation. Eight weeks after hematopoietic stem cell transplantation (HSCT), chimerization efficiency was determined by cytofluorometric analysis of circulating leukocytes. Whole blood was collected via cardiac punctur...
Spinal cord Injury
As described previously, mice were anesthetized via intraperitoneal injection of ketamine (100 mg/kg) and xylazine (10 mg/kg). Following a T9 laminectomy, mice received a 65 kDyn T9 contusion SCI (Infinite Horizons Impactor). Based upon a priori exclusion criteria, any mouse receiving SCI with abnormalities in the force vs. time curve generated by the IH device was considered to have received a "bad hit" and was excluded from analyses (see Table ). Abnormalities meriting exclusion include bone hits or instability in the spinal cord at the time of injury. After injury the muscle incision was closed with an absorbable suture and the skin incision was closed using a monofilament suture. Mice received buprenorphine analgesic (Buprenex SR, 1.0 mg/kg) and Baytril antibiotic (Enrofloxacin, 5.0 mg/kg) subcutaneously once immediately after surgery as wel...
Immunohistochemistry
At the study endpoint, mice were given a lethal dose of ketamine and xylazine. Blood was then collected by cardiac puncture in a heparinized needle and syringe and transferred to an EDTA-coated tube (VWR, 101094-004) for leukocyte isolation (see below). Mice were transcardially perfused with PBS followed by 4% paraformaldehyde (PFA) in PBS (Millipore sigma). A 12 mm section of the spinal cord was collected that spanned the T9 lesion site. The spinal cord sections were postfixed in 4% PFA for 2 h and washed overnight in 0.1 M PB. Spinal cords were dehydrated in 30% sucrose for 1 week. Six millimeters of spinal cord tissue centered on the lesion site was blocked in optimal cutting temperature compound (OCT) (Sakura FineTek, USA, 4583). Each block contained 5 spinal cords (2-3 randomly selected per group). Spinal cords were serially sectioned coronally at a thickness...
Immunohistochemistry
To assess lesion volume, all tissue was stained with eriochrome cyanine and neurofilament heavy, which stain intact myelin and axons, respectively. These markers were used to distinguish lesioned from intact tissue. To stain for neurofilament, sections underwent antigen retrieval in citrate buffer (pH 6.0) at 80°C for 5 minutes. Sections were then treated with 0.3% hydrogen peroxide in 40% methanol and PBS to quench endogenous peroxidase activity. Next, sections were blocked in 5% normal goat serum in PBS with 0.1% Triton-X 100 for 1 hour. Sections were stained overnight at 4°C with neurofilament-200 kD (1:1,500: Ck x NF200; NFH; Aves Labs). Sections were washed in PBS followed by a 1-hour incubation with biotinylated goat anti-chicken (1:2000, BA9010, Vector Laboratories). Sections were then incubated in avidin-biotin complex solution (ABC; 1:200; PK-6100; Vector Laboratori...
Gene expression analysis
At the study endpoint, peripheral blood was collected from all mice via cardiac puncture. Erythrocytes were removed using red blood cell (RBC) lysis buffer (BioLegend, 420301). Collected blood was mixed with RBC lysis buffer and left at room temperature for 5 min. Leukocytes were pelleted by centrifugation at 350 g for 5 min, and the lysis process was repeated twice. Leukocyte pellets were frozen on dry ice. RNA was isolated from leukocyte pellets using the RNeasy mini kit (Qiagen, 74104). RNA concentration was determined using a Nanodrop (Nanodrop Lite; Thermo Fisher Waltham, MA). cDNA libraries were made using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). qRT-PCR was performed using SYBR green master mix and the following forward and reverse primers: (pla2g4a forward= "GATTCTGGAAATGTCTCTGGAAG", reverse="GGCTGACAT...
Measurement outputs
What raw and processed outputs should exist?
Behavioral analysis of locomotor recovery: BMS, Horizontal Ladder, Catwalk gait analysis
- Raw artifact
- Per-run gait capture with paw placement, timing, and stride features for each animal
- Processed artifact
- Cleaned gait metrics table and recovery trend summary across timepoints
- Reported as
- Group comparisons of gait indices, stride metrics, or recovery curves
(BMS score ≥ 3 at 1 dpi)
- Raw artifact
- Per-run gait capture with paw placement, timing, and stride features for each animal
- Processed artifact
- Cleaned gait metrics table and recovery trend summary across timepoints
- Reported as
- Group comparisons of gait indices, stride metrics, or recovery curves
2 mice from cPLA2 KO group excluded based on elevated leukocyte cPLA2 expression at endpoint.
- Raw artifact
- Per-run gait capture with paw placement, timing, and stride features for each animal
- Processed artifact
- Cleaned gait metrics table and recovery trend summary across timepoints
- Reported as
- Group comparisons of gait indices, stride metrics, or recovery curves
To reduce the nonspecific effects of irradiation on the spinal cord, a preliminary dosing study was performed. Wild-type C57BL6 mice were exposed to a split dose of 8, 10.5, or...
- Raw artifact
- Per-run gait capture with paw placement, timing, and stride features for each animal
- Processed artifact
- Cleaned gait metrics table and recovery trend summary across timepoints
- Reported as
- Group comparisons of gait indices, stride metrics, or recovery curves
Analysis plan
How should the outputs become interpretable results?
Acquisition
Collect raw experimental outputs with enough metadata to preserve sample identity, condition, and timing.
inferred from protocolPreprocessing / cleaning
All statistical tests were performed using GraphPad Prism software (v9.4.1, Boston, MA).
from paperScoring or quantification
Quantify the primary readouts for this experiment: Behavioral analysis of locomotor recovery: BMS, Horizontal Ladder, Catwalk gait analysis; (BMS score ≥ 3 at 1 dpi); 2 mice from cPLA2 KO group excluded based on elevated leukocyte cPLA2 expression at endpoint.; To reduce the nonspecific effects of irradiation on the spinal cord, a preliminary dosing study was performed. Wild-type C57BL6 mice were exposed to a split dose of 8, 10.5, or....
from paperStatistical comparison
All statistical tests were performed using GraphPad Prism software (v9.4.1, Boston, MA). All in vitro data were analyzed using an ordinary one-way ANOVA followed by Tukey'...; Fig. 3 HSCT with cPLA2 KO donors reduces cPLA2 expression in circulating leukocytes and in the injured spinal cord. ( A ) Schematic for the HSCT protocol. HSCs isolated from cPL...; To test the hypothesis that MDM cPLA2 limits locomotor recovery after SCI, we assessed locomotor recovery of cPLA2 KO chimeras and WT chimera controls using the BMS score, BMS s...; Fig. 4 HSCT with cPLA2 KO donors did not alter locomotor recovery following SCI relative to WT controls. Mice were injured 10 weeks after HSCT, and recovery was assessed for 6 w...
from paperReporting output
Report representative outputs alongside summary comparisons for Behavioral analysis of locomotor recovery: BMS, Horizontal Ladder, Catwalk gait analysis, (BMS score ≥ 3 at 1 dpi), 2 mice from cPLA2 KO group excluded based on elevated leukocyte cPLA2 expression at endpoint., To reduce the nonspecific effects of irradiation on the spinal cord, a preliminary dosing study was performed. Wild-type C57BL6 mice were exposed to a split dose of 8, 10.5, or....
inferred from protocolStructured statistical methods
All statistical tests were performed using GraphPad Prism software (v9.4.1, Boston, MA). All in vitro data were analyzed using an ordinary one-way ANOVA followed by Tukey'...; Fig. 3 HSCT with cPLA2 KO donors reduces cPLA2 expression in circulating leukocytes and in the injured spinal cord. ( A ) Schematic for the HSCT protocol. HSCs isolated from cPL...; To test the hypothesis that MDM cPLA2 limits locomotor recovery after SCI, we assessed locomotor recovery of cPLA2 KO chimeras and WT chimera controls using the BMS score, BMS s...; Fig. 4 HSCT with cPLA2 KO donors did not alter locomotor recovery following SCI relative to WT controls. Mice were injured 10 weeks after HSCT, and recovery was assessed for 6 w...
source structuredSource and audit
What supports the facts on this page?
Evidence quotes (8)
In these experiments, 2- to 4-month-old female cPLA2 -/- (cPLA2 KO), cPLA2 +/+ (WT) littermate controls, and Actin-GFP C57BL/6 mice were used as hematopoietic stem cell transplant (HSCT) donors. Three-month-old C57BL/6 mice (Jackson Labs, Bar Harbor, Maine) were used as HSCT recipients. cPLA2 KO mice were previously generated, and breeding pairs were generously donated by Dr. Xiao-Ming Xu at the Indiana University School of Medicine and endorsed by Dr. Joseph Bonventre (Harvard University). To reduce the risk of bone marrow rejection or related pathologies (graft versus host disease), cPLA2 KO mice were backcrossed to C57BL/6J females acquired from Jackson Labs. Actin-GFP mice were originally purchased from Jackson Labs but were generously donated by Dr. Ahmed Abdel-Latif at the University of Kentucky. All animals were housed in IVC cages with ad libitum access to food and water. All procedures were performed in accordance with the guidelines and protocols of the Office of Research Integrity and with approval of the Institutional Animal Care and Use Committee at the University of Kentucky. All procedures complied with ARRIVE (Animal Research: Reporting of In Vivo Ex...
Bone marrow-derived macrophages (BMDMs) were extracted from the femur and tibia of cPLA2 KO and WT littermate controls as described previously. BMDMs were plated at 0.8-1 × 10 6 cells/mL in differentiation media containing Roswell Park Memorial Institute medium (RPMI, Thermo Fisher Scientific, #21870-092) supplemented with 1% pen/strep (P/S, Thermo Fisher Scientific, #5140122), 1% HEPES (Sigma-Aldrich, #83264-100ML-F), 1% GlutaMAX 0.001 (Thermo Fisher Scientific, #35050061), 0.001% β-mercaptoethanol (Thermo Fisher Scientific, #21985023), 10% FBS (Life Technologies, #10082147), and 20% supernatant from sL929 cells (a generous gift from Phillip Popovich, The Ohio State University). Supernatant collected from sL929 cells contains macrophage colony-stimulating factor, which helps to promote bone marrow cell differentiation into macrophages. After 7 days of differentiation, cells were transferred to 12-well plates at a density of 1 × 10 6 cells/mL in RPMI containing 1% P/S, 1% GlutaMAX, and 10% FBS. On day 8, cells were stimulated for 24 h with LPS (50 ng/mL, Invivogen, #tlrl-eblps, standard preparation) and IFN-γ (20 ng/mL, eB...
Moderate purity myelin (> 95% myelin, with small contributions from the axolemma and other cellular membranes) was prepared as previously described. Brains were collected from C57BL/6 mice and stored at -80 °C prior to myelin isolation. Brains were first rinsed and suspended in cold PBS with 1% P/S (PBS/P/S) and homogenized with the loose and tight pestles of a Dounce homogenizer (DWK Life Science, #357544). The resulting suspension was transferred to a 15 mL tube and pelleted at 447 g prior to discarding the supernatant. The pellet was resuspended in PBS/P/S, and then 5 mL of a 30% Percoll solution (Sigma-Aldrich, #P1644-500ML) was gently dispensed below the myelin solution to perform density-graded centrifugation. The layers were then centrifuged at 447 g for 15 min at 4 °C under gentle acceleration/deceleration. This generated three distinct layers (soluble on top, myelin in middle, and Percoll/cell pellet on bottom). After removing the soluble fraction, the myelin was transferred to a fresh tube, resuspended in 10 mL of distilled water with 1% P/S, and incubated for 10 min at 4 °C to induce hypoosmotic shock to f...
To reduce the nonspecific effects of irradiation on the spinal cord, a preliminary dosing study was performed. Wild-type C57BL6 mice were exposed to a split dose of 8, 10.5, or 13 Gy of radiation from a Cesium-137 radioactive core. The two half doses were separated by 3 h. Hematopoietic stem cells (HSCs) were isolated from Actin-GFP donors, and 1 × 10 6 HSCs were administered by retro-orbital injection into recipients one hour after the last dose of radiation. Mice were maintained on water supplemented with antibiotics (40 mg sulfamethoxazole/8 mg trimethoprim per 100 ml water) (Bactrim) for one week prior to and 4 weeks after irradiation. Eight weeks after hematopoietic stem cell transplantation (HSCT), chimerization efficiency was determined by cytofluorometric analysis of circulating leukocytes. Whole blood was collected via cardiac puncture. Following the removal of erythrocytes by hyperosmotic lysis in ammonium chloride and Fc blocking (BD, 553142), leukocytes were stained with CD45-APC (BD Pharmingen, 559864), CD11b (Biolegend, 101235), and Ly6G (BD Biosciences, 560601). Stained blood samples were analyzed using a BD FACSymphony, a...
As described previously, mice were anesthetized via intraperitoneal injection of ketamine (100 mg/kg) and xylazine (10 mg/kg). Following a T9 laminectomy, mice received a 65 kDyn T9 contusion SCI (Infinite Horizons Impactor). Based upon a priori exclusion criteria, any mouse receiving SCI with abnormalities in the force vs. time curve generated by the IH device was considered to have received a "bad hit" and was excluded from analyses (see Table ). Abnormalities meriting exclusion include bone hits or instability in the spinal cord at the time of injury. After injury the muscle incision was closed with an absorbable suture and the skin incision was closed using a monofilament suture. Mice received buprenorphine analgesic (Buprenex SR, 1.0 mg/kg) and Baytril antibiotic (Enrofloxacin, 5.0 mg/kg) subcutaneously once immediately after surgery as well as saline (1.0 mL) and antibiotic (5 mg/kg) subcutaneously for 5 days following surgery.
At the study endpoint, mice were given a lethal dose of ketamine and xylazine. Blood was then collected by cardiac puncture in a heparinized needle and syringe and transferred to an EDTA-coated tube (VWR, 101094-004) for leukocyte isolation (see below). Mice were transcardially perfused with PBS followed by 4% paraformaldehyde (PFA) in PBS (Millipore sigma). A 12 mm section of the spinal cord was collected that spanned the T9 lesion site. The spinal cord sections were postfixed in 4% PFA for 2 h and washed overnight in 0.1 M PB. Spinal cords were dehydrated in 30% sucrose for 1 week. Six millimeters of spinal cord tissue centered on the lesion site was blocked in optimal cutting temperature compound (OCT) (Sakura FineTek, USA, 4583). Each block contained 5 spinal cords (2-3 randomly selected per group). Spinal cords were serially sectioned coronally at a thickness of 10 µm in the coronal orientation. Tissue was collected on ColorFrost Plus Microscope Slides (Fisher Scientific). Ten sets of tissue were generated for each block that spanned the length of the lesion, and the distance between each section on a single slide was 100 µm.
To assess lesion volume, all tissue was stained with eriochrome cyanine and neurofilament heavy, which stain intact myelin and axons, respectively. These markers were used to distinguish lesioned from intact tissue. To stain for neurofilament, sections underwent antigen retrieval in citrate buffer (pH 6.0) at 80°C for 5 minutes. Sections were then treated with 0.3% hydrogen peroxide in 40% methanol and PBS to quench endogenous peroxidase activity. Next, sections were blocked in 5% normal goat serum in PBS with 0.1% Triton-X 100 for 1 hour. Sections were stained overnight at 4°C with neurofilament-200 kD (1:1,500: Ck x NF200; NFH; Aves Labs). Sections were washed in PBS followed by a 1-hour incubation with biotinylated goat anti-chicken (1:2000, BA9010, Vector Laboratories). Sections were then incubated in avidin-biotin complex solution (ABC; 1:200; PK-6100; Vector Laboratories) and developed using 3,3'-diaminobenzidine (DAB). Sections were counterstained with eriochrome cyanine to visualize spared white matter. Stained slides were dehydrated using graded ethanol dilutions, cleared using Histoclear (101412-878; VWR Scientific), and coverslipped using Permount (SP1...
At the study endpoint, peripheral blood was collected from all mice via cardiac puncture. Erythrocytes were removed using red blood cell (RBC) lysis buffer (BioLegend, 420301). Collected blood was mixed with RBC lysis buffer and left at room temperature for 5 min. Leukocytes were pelleted by centrifugation at 350 g for 5 min, and the lysis process was repeated twice. Leukocyte pellets were frozen on dry ice. RNA was isolated from leukocyte pellets using the RNeasy mini kit (Qiagen, 74104). RNA concentration was determined using a Nanodrop (Nanodrop Lite; Thermo Fisher Waltham, MA). cDNA libraries were made using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). qRT-PCR was performed using SYBR green master mix and the following forward and reverse primers: (pla2g4a forward= "GATTCTGGAAATGTCTCTGGAAG", reverse="GGCTGACATTTTTCATTAGCTC"; GAPDH, forward="CATCACTGCCACCCAGAAGACTG ", reverse="ATGCCAGTGAGCTTCCCGTTCAG ").
Machine-readable layer
[
{
"@context": "https://schema.org",
"@type": "HowTo",
"name": "Cytosolic phospholipase A2 in infiltrating monocyte derived macrophages does not impair recovery after spinal cord injury in female mice methods",
"description": "Evidence-backed execution summary for Cytosolic phospholipase A2 in infiltrating monocyte derived macrophages does not impair recovery after spinal cord injury in female mice methods from Cytosolic phospholipase A2 in infiltrating monocyte derived macrophages does not impair recovery after spinal cord injury in female mice.",
"totalTime": "PT17765M",
"step": [
{
"@type": "HowToStep",
"position": 1,
"name": "Materials and methods",
"text": "In these experiments, 2- to 4-month-old female cPLA2 -/- (cPLA2 KO), cPLA2 +/+ (WT) littermate controls, and Actin-GFP C57BL/6 mice were used as hematopoietic stem cell transplant (HSCT) donors. Three-month-old C57BL/6 mice (Jackson Labs, Bar Harbor, Maine) were used as HSCT recipients. cPLA2 KO mice were previously generated, and breeding pairs were generously donated by Dr. Xiao-Ming Xu at the Indiana University School of Medicine and endorsed by Dr. Joseph Bonventre (Harvard University). To reduce the risk of bone marrow rejection or related pathologies (graft versus host disease), cPLA2 KO mice were backcrossed to C57BL/6J females acquired from Jackson Labs. Actin-GFP mice were originally purchased from Jackson Labs but were generously donated by Dr. Ahmed Abdel-Latif at the University of Kentucky. All animals were housed in IVC cages with ad libitum access to food an..."
},
{
"@type": "HowToStep",
"position": 2,
"name": "Cell culture",
"text": "Bone marrow-derived macrophages (BMDMs) were extracted from the femur and tibia of cPLA2 KO and WT littermate controls as described previously. BMDMs were plated at 0.8-1 × 10 6 cells/mL in differentiation media containing Roswell Park Memorial Institute medium (RPMI, Thermo Fisher Scientific, #21870-092) supplemented with 1% pen/strep (P/S, Thermo Fisher Scientific, #5140122), 1% HEPES (Sigma-Aldrich, #83264-100ML-F), 1% GlutaMAX 0.001 (Thermo Fisher Scientific, #35050061), 0.001% β-mercaptoethanol (Thermo Fisher Scientific, #21985023), 10% FBS (Life Technologies, #10082147), and 20% supernatant from sL929 cells (a generous gift from Phillip Popovich, The Ohio State University). Supernatant collected from sL929 cells contains macrophage colony-stimulating factor, which helps to promote bone marrow cell differentiation into macrophages. After 7 days of di..."
},
{
"@type": "HowToStep",
"position": 3,
"name": "Myelin isolation",
"text": "Moderate purity myelin (> 95% myelin, with small contributions from the axolemma and other cellular membranes) was prepared as previously described. Brains were collected from C57BL/6 mice and stored at -80 °C prior to myelin isolation. Brains were first rinsed and suspended in cold PBS with 1% P/S (PBS/P/S) and homogenized with the loose and tight pestles of a Dounce homogenizer (DWK Life Science, #357544). The resulting suspension was transferred to a 15 mL tube and pelleted at 447 g prior to discarding the supernatant. The pellet was resuspended in PBS/P/S, and then 5 mL of a 30% Percoll solution (Sigma-Aldrich, #P1644-500ML) was gently dispensed below the myelin solution to perform density-graded centrifugation. The layers were then centrifuged at 447 g for 15 min at 4 °C under gentle acceleration/deceleration. This generated three d..."
},
{
"@type": "HowToStep",
"position": 4,
"name": "Hematopoietic stem cell transplantation",
"text": "To reduce the nonspecific effects of irradiation on the spinal cord, a preliminary dosing study was performed. Wild-type C57BL6 mice were exposed to a split dose of 8, 10.5, or 13 Gy of radiation from a Cesium-137 radioactive core. The two half doses were separated by 3 h. Hematopoietic stem cells (HSCs) were isolated from Actin-GFP donors, and 1 × 10 6 HSCs were administered by retro-orbital injection into recipients one hour after the last dose of radiation. Mice were maintained on water supplemented with antibiotics (40 mg sulfamethoxazole/8 mg trimethoprim per 100 ml water) (Bactrim) for one week prior to and 4 weeks after irradiation. Eight weeks after hematopoietic stem cell transplantation (HSCT), chimerization efficiency was determined by cytofluorometric analysis of circulating leukocytes. Whole blood was collected via cardiac punctur..."
},
{
"@type": "HowToStep",
"position": 5,
"name": "Spinal cord Injury",
"text": "As described previously, mice were anesthetized via intraperitoneal injection of ketamine (100 mg/kg) and xylazine (10 mg/kg). Following a T9 laminectomy, mice received a 65 kDyn T9 contusion SCI (Infinite Horizons Impactor). Based upon a priori exclusion criteria, any mouse receiving SCI with abnormalities in the force vs. time curve generated by the IH device was considered to have received a \"bad hit\" and was excluded from analyses (see Table ). Abnormalities meriting exclusion include bone hits or instability in the spinal cord at the time of injury. After injury the muscle incision was closed with an absorbable suture and the skin incision was closed using a monofilament suture. Mice received buprenorphine analgesic (Buprenex SR, 1.0 mg/kg) and Baytril antibiotic (Enrofloxacin, 5.0 mg/kg) subcutaneously once immediately after surgery as wel..."
},
{
"@type": "HowToStep",
"position": 6,
"name": "Immunohistochemistry",
"text": "At the study endpoint, mice were given a lethal dose of ketamine and xylazine. Blood was then collected by cardiac puncture in a heparinized needle and syringe and transferred to an EDTA-coated tube (VWR, 101094-004) for leukocyte isolation (see below). Mice were transcardially perfused with PBS followed by 4% paraformaldehyde (PFA) in PBS (Millipore sigma). A 12 mm section of the spinal cord was collected that spanned the T9 lesion site. The spinal cord sections were postfixed in 4% PFA for 2 h and washed overnight in 0.1 M PB. Spinal cords were dehydrated in 30% sucrose for 1 week. Six millimeters of spinal cord tissue centered on the lesion site was blocked in optimal cutting temperature compound (OCT) (Sakura FineTek, USA, 4583). Each block contained 5 spinal cords (2-3 randomly selected per group). Spinal cords were serially sectioned coronally at a thickness..."
},
{
"@type": "HowToStep",
"position": 7,
"name": "Immunohistochemistry",
"text": "To assess lesion volume, all tissue was stained with eriochrome cyanine and neurofilament heavy, which stain intact myelin and axons, respectively. These markers were used to distinguish lesioned from intact tissue. To stain for neurofilament, sections underwent antigen retrieval in citrate buffer (pH 6.0) at 80°C for 5 minutes. Sections were then treated with 0.3% hydrogen peroxide in 40% methanol and PBS to quench endogenous peroxidase activity. Next, sections were blocked in 5% normal goat serum in PBS with 0.1% Triton-X 100 for 1 hour. Sections were stained overnight at 4°C with neurofilament-200 kD (1:1,500: Ck x NF200; NFH; Aves Labs). Sections were washed in PBS followed by a 1-hour incubation with biotinylated goat anti-chicken (1:2000, BA9010, Vector Laboratories). Sections were then incubated in avidin-biotin complex solution (ABC; 1:200; PK-6100; Vector Laboratori..."
},
{
"@type": "HowToStep",
"position": 8,
"name": "Gene expression analysis",
"text": "At the study endpoint, peripheral blood was collected from all mice via cardiac puncture. Erythrocytes were removed using red blood cell (RBC) lysis buffer (BioLegend, 420301). Collected blood was mixed with RBC lysis buffer and left at room temperature for 5 min. Leukocytes were pelleted by centrifugation at 350 g for 5 min, and the lysis process was repeated twice. Leukocyte pellets were frozen on dry ice. RNA was isolated from leukocyte pellets using the RNeasy mini kit (Qiagen, 74104). RNA concentration was determined using a Nanodrop (Nanodrop Lite; Thermo Fisher Waltham, MA). cDNA libraries were made using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). qRT-PCR was performed using SYBR green master mix and the following forward and reverse primers: (pla2g4a forward= \"GATTCTGGAAATGTCTCTGGAAG\", reverse=\"GGCTGACAT..."
}
],
"tool": [
{
"@type": "HowToTool",
"name": "Materials and methods"
},
{
"@type": "HowToTool",
"name": "Cell culture"
},
{
"@type": "HowToTool",
"name": "Neurotoxicity assay"
},
{
"@type": "HowToTool",
"name": "Reactive oxygen species assay"
},
{
"@type": "HowToTool",
"name": "Arginase activity assay"
},
{
"@type": "HowToTool",
"name": "Hematopoietic stem cell transplantation"
},
{
"@type": "HowToTool",
"name": "Behavioral assessment of locomotor recovery"
},
{
"@type": "HowToTool",
"name": "Behavioral assessment of locomotor recovery"
}
],
"supply": [
{
"@type": "HowToSupply",
"name": "Cell culture"
},
{
"@type": "HowToSupply",
"name": "Myelin isolation"
},
{
"@type": "HowToSupply",
"name": "Neurotoxicity assay"
},
{
"@type": "HowToSupply",
"name": "Reactive oxygen species assay"
},
{
"@type": "HowToSupply",
"name": "Arginase activity assay"
},
{
"@type": "HowToSupply",
"name": "Nitric oxide assay"
},
{
"@type": "HowToSupply",
"name": "Immunohistochemistry"
},
{
"@type": "HowToSupply",
"name": "Immunohistochemistry"
}
],
"isBasedOn": {
"@type": "ScholarlyArticle",
"headline": "Cytosolic phospholipase A2 in infiltrating monocyte derived macrophages does not impair recovery after spinal cord injury in female mice",
"datePublished": "2025",
"author": [
{
"@type": "Person",
"name": "Ethan P. Glaser"
},
{
"@type": "Person",
"name": "Timothy J. Kopper"
},
{
"@type": "Person",
"name": "William M. Bailey"
},
{
"@type": "Person",
"name": "Hassan K. Kashif"
},
{
"@type": "Person",
"name": "Reena Kumari"
},
{
"@type": "Person",
"name": "Andrew N. Stewart"
},
{
"@type": "Person",
"name": "John C. Gensel"
}
],
"identifier": "10.1038/s41598-024-84936-6"
}
},
{
"@context": "https://schema.org",
"@type": "BreadcrumbList",
"itemListElement": [
{
"@type": "ListItem",
"position": 1,
"name": "Experiments",
"item": "https://replicatescience.com/experiments"
},
{
"@type": "ListItem",
"position": 2,
"name": "Cytosolic phospholipase A2 in infiltrating monocyte derived macrophages does not impair recovery after spinal cord injury in female mice methods",
"item": "https://replicatescience.com/experiments/cytosolic-phospholipase-a2-in-infiltrating-monocyte-derived-macrophages-does-not-impair-recovery-after-spinal-cord-injury-in-female-mice-methods-ethan-p-glaser-pmc11696740/cytosolic-phospholipase-a2-in-infiltrating-monocyte-derived-macrophages-does-not-impair-recovery-aft-mlph8j9y"
}
]
}
]