Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer's disease in rodent models methods
Aim. Evidence-backed execution summary for Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer's disease in rodent models methods from Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer's disease in rodent models.
Show snapshot details
On this page
This experiment, in seven questions
Jump straight to the part of the recipe you need. Data and provenance labels stay close to the action they support.
Shopping and prep list
What do I need before I start?
mouse
Subject model for the experiment.
- Use
- confirm full cohort details in the source paper
Chloride channels regulate the effects of fenamates on NLRP3
reagent used in the protocol.
- Use
- To further identify the mechanism of action of fenamates on NLRP3, we sought to determine the reversibility of fenamate inhibition of NLRP3-dependent IL-1β release. Flufenamic acid did not react with protected cysteine in contrast to 3,4-methylenedioxy-β-nitrostyrene (MNS; ), a known inhibitor of NLRP3 via...
Fenamates inhibit NLRP3 inflammasomes in vivo
reagent used in the protocol.
- Use
- We next tested whether the fenamates would have any effect on the NLRP3 inflammasome in vivo. Initially, we used a mouse air pouch model in which MSU-induced IL-1β production is NLRP3 inflammasome dependent. Seven days after the air pouches were raised in the dorsum of C57BL/6 mice they were injected with MSU...
Cell culture and assays
reagent used in the protocol.
- Use
- iBMDMs were obtained from Clare Bryant (Department of Veterinary Medicine, University of Cambridge). iBMDMs were cultured in Dulbecco's Modified Eagle's Medium (DMEM), 10% fetal bovine serum (FBS, Life Technologies), 100 U ml -1 penicillin and 100 µg ml -1 streptomycin (PenSt...
Western blotting
reagent used in the protocol.
- Use
- Western blot analysis was performed on supernatants for IL-1β and caspase-1. Samples were run on 12% (IL-1β) or 15% (caspase-1) SDS polyacrylamide gels. For caspase-1 blots THP-1 supernatants were concentrated before preparation and loading by centrifugal filtering (Amicon 10 K centrifugal filters) a...
Cell death assays
reagent used in the protocol.
- Use
- Cell death was measured by assessing lactate dehydrogenase release using the CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega) according to manufacturer's instructions.
ASC speck imaging
reagent used in the protocol.
- Use
- Live imaging of ASC speck formation was performed using iBMDMs transfected to stably express ASC conjugated to mCherry protein. Mouse ASC (Accession Number NM_023258 ) was amplified by PCR using primers flanked by gateway recombination sequences (forward primer: 5′- ATGGGGCGGGCACGAGATGCC -3′, reverse pri...
Electrophysiological recordings
reagent used in the protocol.
- Use
- Membrane currents were measured using the whole-cell configuration of the patch-clamp technique. An EPC-10 patch-clamp amplifier (HEKA) was interfaced to a computer for pulse application and data recording using the programme PatchMaster (HEKA). Patch electrodes of 3-5 MΩ were fabricated on a two-stage pu...
Fluorescence imaging
reagent used in the protocol.
- Use
- 10 5 iBMDMs were seeded one day before experiments on glass coverslips in 24-well plates and primed with LPS (1 µg ml -1, 4 h) before fluorescence imaging experiments. Subsequently cells were loaded with fluorescent dyes in Na + /K + containing extracellular solution at room temperature...
Fenamates inhibit NLRP3 inflammasomes in vivo
We next tested whether the fenamates would have any effect on the NLRP3 inflammasome in vivo. Initially, we used a mouse air pouch model in which MSU-induced IL-1β production is NLRP3 inflammasome dependent. Seven days after the air pouches were raised in the dorsum of C57BL/6 mice they were injected with MSU...
- Use
- We next tested whether the fenamates would have any effect on the NLRP3 inflammasome in vivo. Initially, we used a mouse air pouch model in which MSU-induced IL-1β production is NLRP3 inflammasome dependent. Seven days after the air pouches were raised in the dorsum of C57BL/6 mice they were injected with MSU...
Western blotting
Western blot analysis was performed on supernatants for IL-1β and caspase-1. Samples were run on 12% (IL-1β) or 15% (caspase-1) SDS polyacrylamide gels. For caspase-1 blots THP-1 supernatants were concentrated before preparation and loading by centrifugal filtering (Amicon 10 K centrifugal filters) a...
- Use
- Western blot analysis was performed on supernatants for IL-1β and caspase-1. Samples were run on 12% (IL-1β) or 15% (caspase-1) SDS polyacrylamide gels. For caspase-1 blots THP-1 supernatants were concentrated before preparation and loading by centrifugal filtering (Amicon 10 K centrifugal filters) a...
ASC speck imaging
Live imaging of ASC speck formation was performed using iBMDMs transfected to stably express ASC conjugated to mCherry protein. Mouse ASC (Accession Number NM_023258 ) was amplified by PCR using primers flanked by gateway recombination sequences (forward primer: 5′- ATGGGGCGGGCACGAGATGCC -3′, reverse pri...
- Use
- Live imaging of ASC speck formation was performed using iBMDMs transfected to stably express ASC conjugated to mCherry protein. Mouse ASC (Accession Number NM_023258 ) was amplified by PCR using primers flanked by gateway recombination sequences (forward primer: 5′- ATGGGGCGGGCACGAGATGCC -3′, reverse pri...
Cysteine modification and NMR
Flufenamic acid or MNS (0.05 mmol) was dissolved in DMSO- d 6 (400 µl) in an NMR tube. N -Acetyl- L -cysteine methyl ester (17.7 mg, 0.10 mmol) solubilized in DMSO- d 6 (100 µl) was added and an NMR spectrum was recorded every 10 min after the addition for 2 h and then every 1...
- Use
- Flufenamic acid or MNS (0.05 mmol) was dissolved in DMSO- d 6 (400 µl) in an NMR tube. N -Acetyl- L -cysteine methyl ester (17.7 mg, 0.10 mmol) solubilized in DMSO- d 6 (100 µl) was added and an NMR spectrum was recorded every 10 min after the addition for 2 h and then every 1...
Fluorescence imaging
10 5 iBMDMs were seeded one day before experiments on glass coverslips in 24-well plates and primed with LPS (1 µg ml -1, 4 h) before fluorescence imaging experiments. Subsequently cells were loaded with fluorescent dyes in Na + /K + containing extracellular solution at room temperature...
- Use
- 10 5 iBMDMs were seeded one day before experiments on glass coverslips in 24-well plates and primed with LPS (1 µg ml -1, 4 h) before fluorescence imaging experiments. Subsequently cells were loaded with fluorescent dyes in Na + /K + containing extracellular solution at room temperature...
Regulatory volume decrease
THP-1 cells were adjusted to a density of 1 × 10 6 cells per ml in RPMI media (10% FBS, 1% P/S, 1% Glutamine) and primed with LPS (1 µg ml -1, 4 h). A 300 mOsm isotonic buffer was prepared consisting of 147 mM NaCl, 10 mM HEPES, 13 mM glucose, 2 mM KCl, 2...
- Use
- THP-1 cells were adjusted to a density of 1 × 10 6 cells per ml in RPMI media (10% FBS, 1% P/S, 1% Glutamine) and primed with LPS (1 µg ml -1, 4 h). A 300 mOsm isotonic buffer was prepared consisting of 147 mM NaCl, 10 mM HEPES, 13 mM glucose, 2 mM KCl, 2...
Air pouch inflammation model
The air pouch model was used to assess the NLRP3-dependent response to MSU crystals. On day 0 a subcutaneous air pouch was raised in the dorsum of male C57BL/6 mice (30-35 g) by the injection of 4 ml sterile air (filtered through 0.22 µm pore size) with a 25 gauge needle. This was repea...
- Use
- The air pouch model was used to assess the NLRP3-dependent response to MSU crystals. On day 0 a subcutaneous air pouch was raised in the dorsum of male C57BL/6 mice (30-35 g) by the injection of 4 ml sterile air (filtered through 0.22 µm pore size) with a 25 gauge needle. This was repea...
Novel object recognition
NOR was performed as previously described. Briefly, the rats were placed in the NOR box (52 × 52 × 31 cm) and left free to explore two copies of the same object for 3 min (Acquisition phase). Animals were taken out of the box for an inter-trial interval (2 min) then placed back in the sa...
- Use
- NOR was performed as previously described. Briefly, the rats were placed in the NOR box (52 × 52 × 31 cm) and left free to explore two copies of the same object for 3 min (Acquisition phase). Animals were taken out of the box for an inter-trial interval (2 min) then placed back in the sa...
Statistical analyses
Software used for acquisition, scoring, statistics, or reporting.
- Use
- Data are presented as mean values+standard error of the mean (s.e.m). Statistical analyses performed were one-sample t -tests, one-way analysis of variance (ANOVA) and two-way ANOVA tests with Sidak corrected post hoc. Equal variance and normality were assessed with the Levene's test and the Shapiro-wilk test...
Before you run
What should be confirmed before execution?
First confirmation
Equipment is listed but no product mappings are linked.
Confirm before execution
This page is backed by a publishable Replication Data Ledger package with zero critical source-verification issues.
Confirm before execution
Open the source paper before finalizing run-specific details.
Procurement checkpoint
Use source-stated vendors where present. Treat mapped products as sourcing options unless the page marks an exact source match.
Open quote workflowStep-by-step procedure
What do I do, in order?
Chloride channels regulate the effects of fenamates on NLRP3
To further identify the mechanism of action of fenamates on NLRP3, we sought to determine the reversibility of fenamate inhibition of NLRP3-dependent IL-1β release. Flufenamic acid did not react with protected cysteine in contrast to 3,4-methylenedioxy-β-nitrostyrene (MNS; ), a known inhibitor of NLRP3 via irreversible cysteine modification. Thus the mechanism of fenamate action does not involve irreversible cysteine modification. Following the secretion protocol above, except with three media changes over 15 min to wash out the fenamates flufenamic acid and mefenamic acid, the reversible caspase-1 inhibitor Ac-YVAD-cho, and the irreversible NLRP3 inhibitor MNS, it was revealed that the inhibitory effects of the fenamates on NLRP3-dependent IL-1β release were fully reversible ( ). A further experiment, with just one wash, which failed to remove the inhibitor effe...
Fenamates inhibit NLRP3 inflammasomes in vivo
We also tested the effect of fenamates in more disease relevant models. Inflammation contributes to the progression of Alzheimer's disease, and on-going research is establishing the NLRP3-inflammasome as central to the development of inflammation, pathology and memory deficits in a mouse model of Alzheimer's disease. Amyloid beta (Aβ) is a causative factor in the development of Alzheimer's disease and is a known activator of the NLRP3 inflammasome. Mefenamic acid is used routinely in clinical practice and so we tested the effects of mefenamic acid in an in vivo model of Aβ-induced memory loss. Rats injected intracerebroventricularly with soluble Aβ 1-42 oligomers or vehicle were also treated with daily injections of mefenamic acid (5 mg kg -1, i.p.) or vehicle for 14 days. Mefenamic acid treatment prevented Aβ 1-42 induced memory...
Fenamates inhibit NLRP3 inflammasomes in vivo
Following the acute Aβ 1-42 injection model, we then tested the efficacy of mefenamic acid in 3 × TgAD transgenic mice (a mouse model for Alzheimer's disease). For this we used a therapeutic administration strategy beginning at an age where pathology and memory deficits have previously been described in the 3 × TgAD model. At 13-14 months of age administration of mefenamic acid by osmotic minipump over 28 days (at 25 mg kg -1 per day) completely abated memory deficits in the 3 × TgAD mice as measured by NOR ( ). The brains of these mice were sectioned and stained for IL-1β and, using Iba1, for microglia. Microglial activation states were scored by morphology as described in the Methods section (, modified scale from published literature ). In 3 × TgAD mice it has previously been established that amyloid pathology begins to...
Cell culture and assays
iBMDMs were obtained from Clare Bryant (Department of Veterinary Medicine, University of Cambridge). iBMDMs were cultured in Dulbecco's Modified Eagle's Medium (DMEM), 10% fetal bovine serum (FBS, Life Technologies), 100 U ml -1 penicillin and 100 µg ml -1 streptomycin (PenStrep). Cells were seeded overnight at 5 × 10 5 ml -1 in 24- or 96-well plates. Cells were primed with LPS then treated with drug or vehicle (DMSO) in serum-free media for 15 min. Following drug incubation, inflammasomes were stimulated by adding ATP (5 mM) for 1 h. Supernatants were removed and analysed for IL-1β content by ELISA (DuoSet, R&D systems) according to manufacturer's instructions. Primary mouse BMDMs were isolated by flushing marrow from femurs and tibias of wild-type C57BL/6 (Charles River) or NLRP3 -/- mice a...
Western blotting
Western blot analysis was performed on supernatants for IL-1β and caspase-1. Samples were run on 12% (IL-1β) or 15% (caspase-1) SDS polyacrylamide gels. For caspase-1 blots THP-1 supernatants were concentrated before preparation and loading by centrifugal filtering (Amicon 10 K centrifugal filters) according to manufacturer's instructions. Gels were transferred at 15 V onto nitrocellulose membrane (GE Life Sciences) using a Trans-Blot s.d. semi-dry transfer system (Bio-Rad) before blocking with 5% w/v milk in phosphate-buffered saline, 1% Tween 20 (Sigma) (PBST) for 1 h at room temperature. Membranes were washed and incubated (4 °C) overnight in goat anti-mouse IL-1β (100 ng ml -1, R&D Systems) or rabbit anti-human caspase-1 p10 (666.6 ng ml -1, Santa Cruz) primary antibodies in PBST, 0.1% bovine serum a...
Cysteine modification and NMR
Flufenamic acid or MNS (0.05 mmol) was dissolved in DMSO- d 6 (400 µl) in an NMR tube. N -Acetyl- L -cysteine methyl ester (17.7 mg, 0.10 mmol) solubilized in DMSO- d 6 (100 µl) was added and an NMR spectrum was recorded every 10 min after the addition for 2 h and then every 1 h until 24 h. A Bruker Avance 400 spectrometer was used to record 1 H spectra at 300.1 MHz. Chemical shifts are defined in parts per million and referenced against tetramethylsilane ( δ =0). NMR analysis was conducted using Bruker's TopSpin software package.
Electrophysiological recordings
Membrane currents were measured using the whole-cell configuration of the patch-clamp technique. An EPC-10 patch-clamp amplifier (HEKA) was interfaced to a computer for pulse application and data recording using the programme PatchMaster (HEKA). Patch electrodes of 3-5 MΩ were fabricated on a two-stage puller (Narishige PC-10) from borosilicate glass (Hilgenberg). For all electrophysiological experiments, 10 5 iBMDM cells were seeded in 24-well plates on glass coverslips and primed the next day with 1 µg ml -1 LPS for 4 h. For electrophysiological recordings of ATP-induced cation currents, patch electrodes were filled with an intracellular solution containing (in mM): KCl, 120; HEPES, 10; EGTA, 11; CaCl 2, 1; MgCl 2, 2 (pH 7.3). LPS-primed iBMDM cells were superfused with extracellular solution containing (in mM): NaCl, 130; KCl, 5; HEPES, 10;...
Fluorescence imaging
10 5 iBMDMs were seeded one day before experiments on glass coverslips in 24-well plates and primed with LPS (1 µg ml -1, 4 h) before fluorescence imaging experiments. Subsequently cells were loaded with fluorescent dyes in Na + /K + containing extracellular solution at room temperature (20-23 °C): for Ca 2+ imaging experiments with 3 µM fura-2-acetoxymethylester (Fura-2-AM) for 30 min, for Na + imaging experiments with 10 µM sodium-binding benzofuran-isophthalate acetoxymethyl ester (SBFI-AM; both dyes from Molecular Probes) for 60 min. After washing with extracellular solution, glass coverslips were mounted in a chamber on an inverted Olympus IX50 microscope equipped with a × 40 water immersion objective UApo/340 (Olympus Optical, Co.). The fluorescence imaging system consisted of a monochromator,...
Measurement outputs
What raw and processed outputs should exist?
We next tested whether the fenamates would have any effect on the NLRP3 inflammasome in vivo. Initially, we used a mouse air pouch model in which MSU-induced IL-1β product...
- Raw artifact
- Membrane or gel image with visible bands for target and control proteins
- Processed artifact
- Band quantification and normalized densitometry values
- Reported as
- Relative expression values or fold-change comparisons across groups
Following the acute Aβ 1-42 injection model, we then tested the efficacy of mefenamic acid in 3 × TgAD transgenic mice (a mouse model for Alzheimer's disease). F...
- Raw artifact
- Membrane or gel image with visible bands for target and control proteins
- Processed artifact
- Band quantification and normalized densitometry values
- Reported as
- Relative expression values or fold-change comparisons across groups
IBMDMs were obtained from Clare Bryant (Department of Veterinary Medicine, University of Cambridge). iBMDMs were cultured in Dulbecco's Modified Eagle's Medium (DMEM), 10% fetal...
- Raw artifact
- Membrane or gel image with visible bands for target and control proteins
- Processed artifact
- Band quantification and normalized densitometry values
- Reported as
- Relative expression values or fold-change comparisons across groups
Western blot analysis was performed on supernatants for IL-1β and caspase-1. Samples were run on 12% (IL-1β) or 15% (caspase-1) SDS polyacrylamide gels. For caspase-1...
- Raw artifact
- Membrane or gel image with visible bands for target and control proteins
- Processed artifact
- Band quantification and normalized densitometry values
- Reported as
- Relative expression values or fold-change comparisons across groups
Analysis plan
How should the outputs become interpretable results?
Acquisition
Capture matched images from the relevant tissue region using the same acquisition settings across samples.
inferred from protocolPreprocessing / cleaning
We next tested whether the fenamates would have any effect on the NLRP3 inflammasome in vivo.
from paperScoring or quantification
Quantify the primary readouts for this experiment: We next tested whether the fenamates would have any effect on the NLRP3 inflammasome in vivo. Initially, we used a mouse air pouch model in which MSU-induced IL-1β product...; Following the acute Aβ 1-42 injection model, we then tested the efficacy of mefenamic acid in 3 × TgAD transgenic mice (a mouse model for Alzheimer's disease). F...; IBMDMs were obtained from Clare Bryant (Department of Veterinary Medicine, University of Cambridge). iBMDMs were cultured in Dulbecco's Modified Eagle's Medium (DMEM), 10% fetal...; Western blot analysis was performed on supernatants for IL-1β and caspase-1. Samples were run on 12% (IL-1β) or 15% (caspase-1) SDS polyacrylamide gels. For caspase-1....
from paperNormalization
Normalize expression or signal values against the stated control or loading reference before comparing groups.
inferred from protocolStatistical comparison
We next tested whether the fenamates would have any effect on the NLRP3 inflammasome in vivo. Initially, we used a mouse air pouch model in which MSU-induced IL-1β product...; Data are presented as mean values+standard error of the mean (s.e.m). Statistical analyses performed were one-sample t -tests, one-way analysis of variance (ANOVA) and two-way A...
from paperReporting output
Report representative outputs alongside summary comparisons for We next tested whether the fenamates would have any effect on the NLRP3 inflammasome in vivo. Initially, we used a mouse air pouch model in which MSU-induced IL-1β product..., Following the acute Aβ 1-42 injection model, we then tested the efficacy of mefenamic acid in 3 × TgAD transgenic mice (a mouse model for Alzheimer's disease). F..., IBMDMs were obtained from Clare Bryant (Department of Veterinary Medicine, University of Cambridge). iBMDMs were cultured in Dulbecco's Modified Eagle's Medium (DMEM), 10% fetal..., Western blot analysis was performed on supernatants for IL-1β and caspase-1. Samples were run on 12% (IL-1β) or 15% (caspase-1) SDS polyacrylamide gels. For caspase-1....
inferred from protocolStructured statistical methods
We next tested whether the fenamates would have any effect on the NLRP3 inflammasome in vivo. Initially, we used a mouse air pouch model in which MSU-induced IL-1β product...; Data are presented as mean values+standard error of the mean (s.e.m). Statistical analyses performed were one-sample t -tests, one-way analysis of variance (ANOVA) and two-way A...
source structuredSource and audit
What supports the facts on this page?
Evidence quotes (8)
To further identify the mechanism of action of fenamates on NLRP3, we sought to determine the reversibility of fenamate inhibition of NLRP3-dependent IL-1β release. Flufenamic acid did not react with protected cysteine in contrast to 3,4-methylenedioxy-β-nitrostyrene (MNS; ), a known inhibitor of NLRP3 via irreversible cysteine modification. Thus the mechanism of fenamate action does not involve irreversible cysteine modification. Following the secretion protocol above, except with three media changes over 15 min to wash out the fenamates flufenamic acid and mefenamic acid, the reversible caspase-1 inhibitor Ac-YVAD-cho, and the irreversible NLRP3 inhibitor MNS, it was revealed that the inhibitory effects of the fenamates on NLRP3-dependent IL-1β release were fully reversible ( ). A further experiment, with just one wash, which failed to remove the inhibitor effects of YVAD, completely reversed the effects of flufenamic and mefenamic acid on NLRP3 inflammasome inhibition ( ) strongly suggesting that their inhibitory effects were at the plasma membrane. Flufenamic acid is a well-established modulator of ion channels. Thus we first-tested the effects of the...
We also tested the effect of fenamates in more disease relevant models. Inflammation contributes to the progression of Alzheimer's disease, and on-going research is establishing the NLRP3-inflammasome as central to the development of inflammation, pathology and memory deficits in a mouse model of Alzheimer's disease. Amyloid beta (Aβ) is a causative factor in the development of Alzheimer's disease and is a known activator of the NLRP3 inflammasome. Mefenamic acid is used routinely in clinical practice and so we tested the effects of mefenamic acid in an in vivo model of Aβ-induced memory loss. Rats injected intracerebroventricularly with soluble Aβ 1-42 oligomers or vehicle were also treated with daily injections of mefenamic acid (5 mg kg -1, i.p.) or vehicle for 14 days. Mefenamic acid treatment prevented Aβ 1-42 induced memory deficits as measured using the novel object recognition (NOR) test at day 14 (, ). This protective effect was sustained up to day 35, 21 days after the mefenamic acid treatment had been terminated ( ).
Following the acute Aβ 1-42 injection model, we then tested the efficacy of mefenamic acid in 3 × TgAD transgenic mice (a mouse model for Alzheimer's disease). For this we used a therapeutic administration strategy beginning at an age where pathology and memory deficits have previously been described in the 3 × TgAD model. At 13-14 months of age administration of mefenamic acid by osmotic minipump over 28 days (at 25 mg kg -1 per day) completely abated memory deficits in the 3 × TgAD mice as measured by NOR ( ). The brains of these mice were sectioned and stained for IL-1β and, using Iba1, for microglia. Microglial activation states were scored by morphology as described in the Methods section (, modified scale from published literature ). In 3 × TgAD mice it has previously been established that amyloid pathology begins to develop in the subiculum at around 12 months of age. We found that there was substantial microglial activation in the subicula of 3 × TgAD mice, and that the activated/amoeboid microglia expressed IL-1β (, ). No microglial activation or IL-1β expression was seen in other regions of...
iBMDMs were obtained from Clare Bryant (Department of Veterinary Medicine, University of Cambridge). iBMDMs were cultured in Dulbecco's Modified Eagle's Medium (DMEM), 10% fetal bovine serum (FBS, Life Technologies), 100 U ml -1 penicillin and 100 µg ml -1 streptomycin (PenStrep). Cells were seeded overnight at 5 × 10 5 ml -1 in 24- or 96-well plates. Cells were primed with LPS then treated with drug or vehicle (DMSO) in serum-free media for 15 min. Following drug incubation, inflammasomes were stimulated by adding ATP (5 mM) for 1 h. Supernatants were removed and analysed for IL-1β content by ELISA (DuoSet, R&D systems) according to manufacturer's instructions. Primary mouse BMDMs were isolated by flushing marrow from femurs and tibias of wild-type C57BL/6 (Charles River) or NLRP3 -/- mice and cultured with L929 mouse fibroblast supernatant-conditioned media for 7-10 days. Human THP-1 peripheral blood monocyte-like cells were cultured in RPMI-1640 Medium supplemented with 10% FBS, 100 U ml -1, 100 µg ml -1 PenStrep, 20 mM l-Gl...
Western blot analysis was performed on supernatants for IL-1β and caspase-1. Samples were run on 12% (IL-1β) or 15% (caspase-1) SDS polyacrylamide gels. For caspase-1 blots THP-1 supernatants were concentrated before preparation and loading by centrifugal filtering (Amicon 10 K centrifugal filters) according to manufacturer's instructions. Gels were transferred at 15 V onto nitrocellulose membrane (GE Life Sciences) using a Trans-Blot s.d. semi-dry transfer system (Bio-Rad) before blocking with 5% w/v milk in phosphate-buffered saline, 1% Tween 20 (Sigma) (PBST) for 1 h at room temperature. Membranes were washed and incubated (4 °C) overnight in goat anti-mouse IL-1β (100 ng ml -1, R&D Systems) or rabbit anti-human caspase-1 p10 (666.6 ng ml -1, Santa Cruz) primary antibodies in PBST, 0.1% bovine serum albumin (BSA). Following this, membranes were washed and incubated with rabbit anti-goat (550 ng ml -1 ) or goat anti-rabbit IgG (250 µg ml -1, Dako) in 5% milk in PBST for 1 h at room temperature. Finally, membranes were washed and incubated in Amersha...
Flufenamic acid or MNS (0.05 mmol) was dissolved in DMSO- d 6 (400 µl) in an NMR tube. N -Acetyl- L -cysteine methyl ester (17.7 mg, 0.10 mmol) solubilized in DMSO- d 6 (100 µl) was added and an NMR spectrum was recorded every 10 min after the addition for 2 h and then every 1 h until 24 h. A Bruker Avance 400 spectrometer was used to record 1 H spectra at 300.1 MHz. Chemical shifts are defined in parts per million and referenced against tetramethylsilane ( δ =0). NMR analysis was conducted using Bruker's TopSpin software package.
Membrane currents were measured using the whole-cell configuration of the patch-clamp technique. An EPC-10 patch-clamp amplifier (HEKA) was interfaced to a computer for pulse application and data recording using the programme PatchMaster (HEKA). Patch electrodes of 3-5 MΩ were fabricated on a two-stage puller (Narishige PC-10) from borosilicate glass (Hilgenberg). For all electrophysiological experiments, 10 5 iBMDM cells were seeded in 24-well plates on glass coverslips and primed the next day with 1 µg ml -1 LPS for 4 h. For electrophysiological recordings of ATP-induced cation currents, patch electrodes were filled with an intracellular solution containing (in mM): KCl, 120; HEPES, 10; EGTA, 11; CaCl 2, 1; MgCl 2, 2 (pH 7.3). LPS-primed iBMDM cells were superfused with extracellular solution containing (in mM): NaCl, 130; KCl, 5; HEPES, 10; D -glucose, 10; CaCl 2, 2; MgCl 2, 1 (pH 7.4). The effect of flufenamic/mefenamic acid was investigated after a stable cation current was induced by application of 5 mM ATP. DMSO was used as vehicle control in these experiments. Leak-subtracted currents were analysed at +90 mV and dat...
10 5 iBMDMs were seeded one day before experiments on glass coverslips in 24-well plates and primed with LPS (1 µg ml -1, 4 h) before fluorescence imaging experiments. Subsequently cells were loaded with fluorescent dyes in Na + /K + containing extracellular solution at room temperature (20-23 °C): for Ca 2+ imaging experiments with 3 µM fura-2-acetoxymethylester (Fura-2-AM) for 30 min, for Na + imaging experiments with 10 µM sodium-binding benzofuran-isophthalate acetoxymethyl ester (SBFI-AM; both dyes from Molecular Probes) for 60 min. After washing with extracellular solution, glass coverslips were mounted in a chamber on an inverted Olympus IX50 microscope equipped with a × 40 water immersion objective UApo/340 (Olympus Optical, Co.). The fluorescence imaging system consisted of a monochromator, a charge-coupled device (CCD) camera and a Windows 7 based image processing software (Till Photonics). Cells were exposed to alternating 340±5 and 380±5 nm wavelengths of UV light and emission light was passed through a 400 nm dichroic mirror and a 420 nm long pass emissi...
Machine-readable layer
[
{
"@context": "https://schema.org",
"@type": "HowTo",
"name": "Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer's disease in rodent models methods",
"description": "Evidence-backed execution summary for Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer's disease in rodent models methods from Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer's disease in rodent models.",
"totalTime": "PT24960M",
"step": [
{
"@type": "HowToStep",
"position": 1,
"name": "Chloride channels regulate the effects of fenamates on NLRP3",
"text": "To further identify the mechanism of action of fenamates on NLRP3, we sought to determine the reversibility of fenamate inhibition of NLRP3-dependent IL-1β release. Flufenamic acid did not react with protected cysteine in contrast to 3,4-methylenedioxy-β-nitrostyrene (MNS; ), a known inhibitor of NLRP3 via irreversible cysteine modification. Thus the mechanism of fenamate action does not involve irreversible cysteine modification. Following the secretion protocol above, except with three media changes over 15 min to wash out the fenamates flufenamic acid and mefenamic acid, the reversible caspase-1 inhibitor Ac-YVAD-cho, and the irreversible NLRP3 inhibitor MNS, it was revealed that the inhibitory effects of the fenamates on NLRP3-dependent IL-1β release were fully reversible ( ). A further experiment, with just one wash, which failed to remove the inhibitor effe..."
},
{
"@type": "HowToStep",
"position": 2,
"name": "Fenamates inhibit NLRP3 inflammasomes in vivo",
"text": "We also tested the effect of fenamates in more disease relevant models. Inflammation contributes to the progression of Alzheimer's disease, and on-going research is establishing the NLRP3-inflammasome as central to the development of inflammation, pathology and memory deficits in a mouse model of Alzheimer's disease. Amyloid beta (Aβ) is a causative factor in the development of Alzheimer's disease and is a known activator of the NLRP3 inflammasome. Mefenamic acid is used routinely in clinical practice and so we tested the effects of mefenamic acid in an in vivo model of Aβ-induced memory loss. Rats injected intracerebroventricularly with soluble Aβ 1-42 oligomers or vehicle were also treated with daily injections of mefenamic acid (5 mg kg -1, i.p.) or vehicle for 14 days. Mefenamic acid treatment prevented Aβ 1-42 induced memory..."
},
{
"@type": "HowToStep",
"position": 3,
"name": "Fenamates inhibit NLRP3 inflammasomes in vivo",
"text": "Following the acute Aβ 1-42 injection model, we then tested the efficacy of mefenamic acid in 3 × TgAD transgenic mice (a mouse model for Alzheimer's disease). For this we used a therapeutic administration strategy beginning at an age where pathology and memory deficits have previously been described in the 3 × TgAD model. At 13-14 months of age administration of mefenamic acid by osmotic minipump over 28 days (at 25 mg kg -1 per day) completely abated memory deficits in the 3 × TgAD mice as measured by NOR ( ). The brains of these mice were sectioned and stained for IL-1β and, using Iba1, for microglia. Microglial activation states were scored by morphology as described in the Methods section (, modified scale from published literature ). In 3 × TgAD mice it has previously been established that amyloid pathology begins to..."
},
{
"@type": "HowToStep",
"position": 4,
"name": "Cell culture and assays",
"text": "iBMDMs were obtained from Clare Bryant (Department of Veterinary Medicine, University of Cambridge). iBMDMs were cultured in Dulbecco's Modified Eagle's Medium (DMEM), 10% fetal bovine serum (FBS, Life Technologies), 100 U ml -1 penicillin and 100 µg ml -1 streptomycin (PenStrep). Cells were seeded overnight at 5 × 10 5 ml -1 in 24- or 96-well plates. Cells were primed with LPS then treated with drug or vehicle (DMSO) in serum-free media for 15 min. Following drug incubation, inflammasomes were stimulated by adding ATP (5 mM) for 1 h. Supernatants were removed and analysed for IL-1β content by ELISA (DuoSet, R&D systems) according to manufacturer's instructions. Primary mouse BMDMs were isolated by flushing marrow from femurs and tibias of wild-type C57BL/6 (Charles River) or NLRP3 -/- mice a..."
},
{
"@type": "HowToStep",
"position": 5,
"name": "Western blotting",
"text": "Western blot analysis was performed on supernatants for IL-1β and caspase-1. Samples were run on 12% (IL-1β) or 15% (caspase-1) SDS polyacrylamide gels. For caspase-1 blots THP-1 supernatants were concentrated before preparation and loading by centrifugal filtering (Amicon 10 K centrifugal filters) according to manufacturer's instructions. Gels were transferred at 15 V onto nitrocellulose membrane (GE Life Sciences) using a Trans-Blot s.d. semi-dry transfer system (Bio-Rad) before blocking with 5% w/v milk in phosphate-buffered saline, 1% Tween 20 (Sigma) (PBST) for 1 h at room temperature. Membranes were washed and incubated (4 °C) overnight in goat anti-mouse IL-1β (100 ng ml -1, R&D Systems) or rabbit anti-human caspase-1 p10 (666.6 ng ml -1, Santa Cruz) primary antibodies in PBST, 0.1% bovine serum a..."
},
{
"@type": "HowToStep",
"position": 6,
"name": "Cysteine modification and NMR",
"text": "Flufenamic acid or MNS (0.05 mmol) was dissolved in DMSO- d 6 (400 µl) in an NMR tube. N -Acetyl- L -cysteine methyl ester (17.7 mg, 0.10 mmol) solubilized in DMSO- d 6 (100 µl) was added and an NMR spectrum was recorded every 10 min after the addition for 2 h and then every 1 h until 24 h. A Bruker Avance 400 spectrometer was used to record 1 H spectra at 300.1 MHz. Chemical shifts are defined in parts per million and referenced against tetramethylsilane ( δ =0). NMR analysis was conducted using Bruker's TopSpin software package."
},
{
"@type": "HowToStep",
"position": 7,
"name": "Electrophysiological recordings",
"text": "Membrane currents were measured using the whole-cell configuration of the patch-clamp technique. An EPC-10 patch-clamp amplifier (HEKA) was interfaced to a computer for pulse application and data recording using the programme PatchMaster (HEKA). Patch electrodes of 3-5 MΩ were fabricated on a two-stage puller (Narishige PC-10) from borosilicate glass (Hilgenberg). For all electrophysiological experiments, 10 5 iBMDM cells were seeded in 24-well plates on glass coverslips and primed the next day with 1 µg ml -1 LPS for 4 h. For electrophysiological recordings of ATP-induced cation currents, patch electrodes were filled with an intracellular solution containing (in mM): KCl, 120; HEPES, 10; EGTA, 11; CaCl 2, 1; MgCl 2, 2 (pH 7.3). LPS-primed iBMDM cells were superfused with extracellular solution containing (in mM): NaCl, 130; KCl, 5; HEPES, 10;..."
},
{
"@type": "HowToStep",
"position": 8,
"name": "Fluorescence imaging",
"text": "10 5 iBMDMs were seeded one day before experiments on glass coverslips in 24-well plates and primed with LPS (1 µg ml -1, 4 h) before fluorescence imaging experiments. Subsequently cells were loaded with fluorescent dyes in Na + /K + containing extracellular solution at room temperature (20-23 °C): for Ca 2+ imaging experiments with 3 µM fura-2-acetoxymethylester (Fura-2-AM) for 30 min, for Na + imaging experiments with 10 µM sodium-binding benzofuran-isophthalate acetoxymethyl ester (SBFI-AM; both dyes from Molecular Probes) for 60 min. After washing with extracellular solution, glass coverslips were mounted in a chamber on an inverted Olympus IX50 microscope equipped with a × 40 water immersion objective UApo/340 (Olympus Optical, Co.). The fluorescence imaging system consisted of a monochromator,..."
}
],
"tool": [
{
"@type": "HowToTool",
"name": "Fenamates inhibit NLRP3 inflammasomes in vivo"
},
{
"@type": "HowToTool",
"name": "Western blotting"
},
{
"@type": "HowToTool",
"name": "ASC speck imaging"
},
{
"@type": "HowToTool",
"name": "Cysteine modification and NMR"
},
{
"@type": "HowToTool",
"name": "Fluorescence imaging"
},
{
"@type": "HowToTool",
"name": "Regulatory volume decrease"
},
{
"@type": "HowToTool",
"name": "Air pouch inflammation model"
},
{
"@type": "HowToTool",
"name": "Novel object recognition"
}
],
"supply": [
{
"@type": "HowToSupply",
"name": "Chloride channels regulate the effects of fenamates on NLRP3"
},
{
"@type": "HowToSupply",
"name": "Fenamates inhibit NLRP3 inflammasomes in vivo"
},
{
"@type": "HowToSupply",
"name": "Cell culture and assays"
},
{
"@type": "HowToSupply",
"name": "Western blotting"
},
{
"@type": "HowToSupply",
"name": "Cell death assays"
},
{
"@type": "HowToSupply",
"name": "ASC speck imaging"
},
{
"@type": "HowToSupply",
"name": "Electrophysiological recordings"
},
{
"@type": "HowToSupply",
"name": "Fluorescence imaging"
}
],
"isBasedOn": {
"@type": "ScholarlyArticle",
"headline": "Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer's disease in rodent models",
"datePublished": "2016",
"author": [
{
"@type": "Person",
"name": "Michael J. D. Daniels"
},
{
"@type": "Person",
"name": "Jack Rivers-Auty"
},
{
"@type": "Person",
"name": "Tom Schilling"
},
{
"@type": "Person",
"name": "Nicholas G. Spencer"
},
{
"@type": "Person",
"name": "William Watremez"
},
{
"@type": "Person",
"name": "Victoria Fasolino"
},
{
"@type": "Person",
"name": "Sophie J. Booth"
},
{
"@type": "Person",
"name": "Claire S. White"
},
{
"@type": "Person",
"name": "Alex G. Baldwin"
},
{
"@type": "Person",
"name": "Sally Freeman"
},
{
"@type": "Person",
"name": "Raymond Wong"
},
{
"@type": "Person",
"name": "Clare Latta"
},
{
"@type": "Person",
"name": "Shi Yu"
},
{
"@type": "Person",
"name": "Joshua Jackson"
},
{
"@type": "Person",
"name": "Nicolas Fischer"
},
{
"@type": "Person",
"name": "Violette Koziel"
},
{
"@type": "Person",
"name": "Thierry Pillot"
},
{
"@type": "Person",
"name": "James Bagnall"
},
{
"@type": "Person",
"name": "Stuart M. Allan"
},
{
"@type": "Person",
"name": "Pawel Paszek"
},
{
"@type": "Person",
"name": "James Galea"
},
{
"@type": "Person",
"name": "Michael K. Harte"
},
{
"@type": "Person",
"name": "Claudia Eder"
},
{
"@type": "Person",
"name": "Catherine B. Lawrence"
},
{
"@type": "Person",
"name": "David Brough"
}
],
"identifier": "10.1038/ncomms12504"
}
},
{
"@context": "https://schema.org",
"@type": "BreadcrumbList",
"itemListElement": [
{
"@type": "ListItem",
"position": 1,
"name": "Experiments",
"item": "https://replicatescience.com/experiments"
},
{
"@type": "ListItem",
"position": 2,
"name": "Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer's disease in rodent models methods",
"item": "https://replicatescience.com/experiments/fenamate-nsaids-inhibit-the-nlrp3-inflammasome-and-protect-against-alzheimer-s-disease-in-rodent-models-methods-michael-j-d-daniels-pmc4987536/fenamate-nsaids-inhibit-the-nlrp3-inflammasome-and-protect-against-alzheimer-s-disease-in-rodent-mod-mlphawm7"
}
]
}
]