Manganese transporter Slc39a14 deficiency revealed its key role in maintaining manganese homeostasis in mice methods
Aim. Evidence-backed execution summary for Manganese transporter Slc39a14 deficiency revealed its key role in maintaining manganese homeostasis in mice methods from Manganese transporter Slc39a14 deficiency revealed its key role in maintaining manganese homeostasis in mice.
Show snapshot details
On this page
This experiment, in seven questions
Jump straight to the part of the recipe you need. Data and provenance labels stay close to the action they support.
Shopping and prep list
What do I need before I start?
mouse
Subject model for the experiment.
- Use
- confirm full cohort details in the source paper
Loss of Slc39a14 expression leads to Mn accumulation
reagent used in the protocol.
- Use
- Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ]. Therefore, we used inductively coupled plasma mass spectrometry (ICP-MS) to measure the levels of various metals in Slc39a14 -/- and wild-type mice [,, ]. Interestingly, compared with age-matched...
Loss of Slc39a14 expression leads to Mn accumulation
reagent used in the protocol.
- Use
- As early as 8 weeks of age, Slc39a14 -/- mice have brain Mn levels that are ~10-fold higher than age-matched wild-type control mice. We therefore tested whether the effects of Mn accumulation could be reduced by treating mice with the metal chelator Na 2 CaEDTA. At 5 months of age, we treated wild-type a...
High dietary Mn does not lead to hepatic Mn accumulation in hepatocyte-specific Slc39a14 -knockout mice
reagent used in the protocol.
- Use
- Given the systemic accumulation of Mn in Slc39a14 -/- mice, and that the liver is the primary storage site for Slc39a14-mediated Mn uptake in mice, we hypothesized that feeding hepatocyte-specific Slc39a14 fl/fl;Alb-Cre + mice a high Mn diet might increase their brain Mn levels. We therefore fed newly w...
Animal genotyping
reagent used in the protocol.
- Use
- Genomic DNA was extracted from mouse tail biopsies using the TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing, China; Cat. #DP304). The following primer pair was used to genotype the Slc39a14 fl/fl mice: CTGTGGTCTTCCTGCCTTGG and TACCCTGCCCTACACGACTC; the following primer pair was used to genotype the Slc39a14 fl/fl...
Laboratory measurements for ICP-MS detection
reagent used in the protocol.
- Use
- These methods were performed as previously described [,,, ]. Approximately 10-200 mg of each organ was placed in a 25-ml PFA vial with a screw cap and digested with 3.4 ml of concentrated EMSURE nitric acid solution (65%, 1.39 g ml -1, Merck, Darmstadt, Germany). The following...
RNA extraction and qPCR analysis
reagent used in the protocol.
- Use
- Total RNA was extracted from the mouse tissues using TRIzol reagent (Invitrogen, Shanghai, China), and cDNA was synthesized using the PrimerScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China, cat. #RR047). Real-time PCR was performed using the two-step quantitative RT-PCR method in accordance with the ma...
Loss of Slc39a14 expression leads to Mn accumulation
As early as 8 weeks of age, Slc39a14 -/- mice have brain Mn levels that are ~10-fold higher than age-matched wild-type control mice. We therefore tested whether the effects of Mn accumulation could be reduced by treating mice with the metal chelator Na 2 CaEDTA. At 5 months of age, we treated wild-type a...
- Use
- As early as 8 weeks of age, Slc39a14 -/- mice have brain Mn levels that are ~10-fold higher than age-matched wild-type control mice. We therefore tested whether the effects of Mn accumulation could be reduced by treating mice with the metal chelator Na 2 CaEDTA. At 5 months of age, we treated wild-type a...
High dietary Mn does not lead to hepatic Mn accumulation in hepatocyte-specific Slc39a14 -knockout mice
Given the systemic accumulation of Mn in Slc39a14 -/- mice, and that the liver is the primary storage site for Slc39a14-mediated Mn uptake in mice, we hypothesized that feeding hepatocyte-specific Slc39a14 fl/fl;Alb-Cre + mice a high Mn diet might increase their brain Mn levels. We therefore fed newly w...
- Use
- Given the systemic accumulation of Mn in Slc39a14 -/- mice, and that the liver is the primary storage site for Slc39a14-mediated Mn uptake in mice, we hypothesized that feeding hepatocyte-specific Slc39a14 fl/fl;Alb-Cre + mice a high Mn diet might increase their brain Mn levels. We therefore fed newly w...
Behavioral testing
To phenotype the mice in this study, we used the balance beam, accelerating rotarod and CatWalk tests. For each experiment, four pairs of knockout mice and control littermates were used. The mice were trained for three consecutive days and were tested on the fourth day. Thereafter, the tests were repeated once a wee...
- Use
- To phenotype the mice in this study, we used the balance beam, accelerating rotarod and CatWalk tests. For each experiment, four pairs of knockout mice and control littermates were used. The mice were trained for three consecutive days and were tested on the fourth day. Thereafter, the tests were repeated once a wee...
Behavioral testing
The accelerating rotarod [, ] (Softmaze-XR1514, Shanghai, China) consisted of a felt-covered steel cylinder fitted to a rotating pump with a variable speed setting. Age-matched animals were trained on the rotarod for three consecutive days, with three 5-min training trials with the speed set to 10, 12 and 14...
- Use
- The accelerating rotarod [, ] (Softmaze-XR1514, Shanghai, China) consisted of a felt-covered steel cylinder fitted to a rotating pump with a variable speed setting. Age-matched animals were trained on the rotarod for three consecutive days, with three 5-min training trials with the speed set to 10, 12 and 14...
Statistical analysis
At least three independent experiments were used for statistical analyses. GraphPad Prism 5 software was used for statistical analyses, and all data passed the test for normality. Multiples groups were analyzed using a one-way ANOVA with Tukey's post hoc test, and differences between two groups were analyzed u...
- Use
- At least three independent experiments were used for statistical analyses. GraphPad Prism 5 software was used for statistical analyses, and all data passed the test for normality. Multiples groups were analyzed using a one-way ANOVA with Tukey's post hoc test, and differences between two groups were analyzed u...
Behavioral testing
To analyze the animals' gait, we used the CatWalk XT system [ ] (Noldus Information Technology, Wageningen, The Netherlands). To measure the gait, the mouse was placed on a glass plate and allowed to walk along a narrow walkway, with a green light on the walkway and a red ceiling light to illuminate the mouse;...
- Use
- To analyze the animals' gait, we used the CatWalk XT system [ ] (Noldus Information Technology, Wageningen, The Netherlands). To measure the gait, the mouse was placed on a glass plate and allowed to walk along a narrow walkway, with a green light on the walkway and a red ceiling light to illuminate the mouse;...
Laboratory measurements for ICP-MS detection
These methods were performed as previously described [,,, ]. Approximately 10-200 mg of each organ was placed in a 25-ml PFA vial with a screw cap and digested with 3.4 ml of concentrated EMSURE nitric acid solution (65%, 1.39 g ml -1, Merck, Darmstadt, Germany). The following...
- Use
- These methods were performed as previously described [,,, ]. Approximately 10-200 mg of each organ was placed in a 25-ml PFA vial with a screw cap and digested with 3.4 ml of concentrated EMSURE nitric acid solution (65%, 1.39 g ml -1, Merck, Darmstadt, Germany). The following...
RNA extraction and qPCR analysis
Total RNA was extracted from the mouse tissues using TRIzol reagent (Invitrogen, Shanghai, China), and cDNA was synthesized using the PrimerScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China, cat. #RR047). Real-time PCR was performed using the two-step quantitative RT-PCR method in accordance with the ma...
- Use
- Total RNA was extracted from the mouse tissues using TRIzol reagent (Invitrogen, Shanghai, China), and cDNA was synthesized using the PrimerScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China, cat. #RR047). Real-time PCR was performed using the two-step quantitative RT-PCR method in accordance with the ma...
Statistical analysis
Software used for acquisition, scoring, statistics, or reporting.
- Use
- At least three independent experiments were used for statistical analyses. GraphPad Prism 5 software was used for statistical analyses, and all data passed the test for normality. Multiples groups were analyzed using a one-way ANOVA with Tukey's post hoc test, and differences between two groups were analyzed u...
Before you run
What should be confirmed before execution?
First confirmation
Equipment is listed but no product mappings are linked.
Confirm before execution
This page is backed by a publishable Replication Data Ledger package with zero critical source-verification issues.
Confirm before execution
Open the source paper before finalizing run-specific details.
Procurement checkpoint
Use source-stated vendors where present. Treat mapped products as sourcing options unless the page marks an exact source match.
Open quote workflowStep-by-step procedure
What do I do, in order?
Loss of Slc39a14 expression leads to Mn accumulation
Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ]. Therefore, we used inductively coupled plasma mass spectrometry (ICP-MS) to measure the levels of various metals in Slc39a14 -/- and wild-type mice [,, ]. Interestingly, compared with age-matched wild-type controls, at 48 weeks of age the Slc39a14 -/- mice had significantly higher levels of Mn in a wide range of tissues, including the serum, brain, kidney, lung, heart and spleen ( ); Mn levels in the liver and intestine were similar between wild-type and Slc39a14 -/- mice. We found no significant differences between wild-type and Slc39a14 -/- mice with respect to Fe, Zn or Cu in any tissues ( ), with the exception of a slight yet significant increase in serum Fe levels ( ). Taken together, these data indicate that Slc39a14 is pred...
Loss of Slc39a14 expression leads to Mn accumulation
As early as 8 weeks of age, Slc39a14 -/- mice have brain Mn levels that are ~10-fold higher than age-matched wild-type control mice. We therefore tested whether the effects of Mn accumulation could be reduced by treating mice with the metal chelator Na 2 CaEDTA. At 5 months of age, we treated wild-type and Slc39a14 -/- mice with Na 2 CaEDTA for 4 weeks using a standard therapeutic protocol [, ]. Chelation therapy had no effect on serum Mn levels ( ) or rotarod performance ( ) in wild-type mice; however, in Slc39a14 -/- mice, Na 2 CaEDTA treatment significantly reduced serum Mn levels (from 0.1 ng µl -1 to 0.05 ng µl -1; ) and significantly improved performance on the rotarod test ( ).
High dietary Mn does not lead to hepatic Mn accumulation in hepatocyte-specific Slc39a14 -knockout mice
Given the systemic accumulation of Mn in Slc39a14 -/- mice, and that the liver is the primary storage site for Slc39a14-mediated Mn uptake in mice, we hypothesized that feeding hepatocyte-specific Slc39a14 fl/fl;Alb-Cre + mice a high Mn diet might increase their brain Mn levels. We therefore fed newly weaned Slc39a14 fl/fl;Alb-Cre + and control ( Slc39a14 fl/fl;Alb-Cre - ) mice a purified AIN-93G diet containing either a normal (10 p.p.m.) or high (2 400 p.p.m.) concentration of Mn [ ]. After 30 days on a high Mn diet, neither body weight ( ) nor rotarod performance ( ) differed between Slc39a14 fl/fl;Alb-Cre + and control mice; we also found no difference between mice fed a normal Mn diet and mice fed a high Mn diet (compare with, respectively). However, the high Mn diet increased serum Mn levels in both Slc39a14 fl/fl;Alb-Cre + and control m...
Dietary Mn supplementation in hepatocyte-specific Slc39a14 -knockout mice
Control ( Slc39a14 fl/fl;Alb-Cre - ) and Slc39a14 fl/fl;Alb-Cre + mice were fed a purified AIN-93G diet containing either normal (10 p.p.m.) Mn (diet D08080401) or high (2 400 p.p.m.) Mn (diet D17020702) for 30 days. Based on a previous study, 2 400 p.p.m. of dietary Mn does not induce toxicity [ ]. During the 30-day feeding period, body weight, motor performance and ICP-MS metal analysis were performed as described above.
Behavioral testing
To analyze the animals' gait, we used the CatWalk XT system [ ] (Noldus Information Technology, Wageningen, The Netherlands). To measure the gait, the mouse was placed on a glass plate and allowed to walk along a narrow walkway, with a green light on the walkway and a red ceiling light to illuminate the mouse; a camera was used to record the mouse's paw placement while walking. During the test, the mouse was placed in an enclosed box at the end of the walkway and allowed to acclimate for 10 min, after which the lights were turned off, and the mouse was allowed to walk from the beginning of the walkway to the end of the walkway and enter the box. A successful trial was defined as the mouse taking ⩽10 s to cross the field of vision of a video camera that was used to capture the mouse's movement, which was analyzed by CatWalk XT software based on the...
Laboratory measurements for ICP-MS detection
These methods were performed as previously described [,,, ]. Approximately 10-200 mg of each organ was placed in a 25-ml PFA vial with a screw cap and digested with 3.4 ml of concentrated EMSURE nitric acid solution (65%, 1.39 g ml -1, Merck, Darmstadt, Germany). The following microwave program was used for digestion: the temperature of the sample was ramped from room temperature to 200 degrees by microwaving at 1 000 W for 20 min; the microwave power was then held at 1 000 W for an additional 30 min, followed by a 15-min cooling step. The total digestion time was therefore 65 min. The digested samples were dried by heating and immediately diluted to a final volume of 5 ml in high-purity deionized water (18 MΩ cm -1 resistivity) obtained from a Milli-Q Integral 10 purificatio...
Measurement outputs
What raw and processed outputs should exist?
Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ]. Therefore, we used inductively coupled plasma mass spectrometry (ICP-M...
- Raw artifact
- Membrane or gel image with visible bands for target and control proteins
- Processed artifact
- Band quantification and normalized densitometry values
- Reported as
- Relative expression values or fold-change comparisons across groups
As early as 8 weeks of age, Slc39a14 -/- mice have brain Mn levels that are ~10-fold higher than age-matched wild-type control mice. We therefore tested whether the...
- Raw artifact
- Membrane or gel image with visible bands for target and control proteins
- Processed artifact
- Band quantification and normalized densitometry values
- Reported as
- Relative expression values or fold-change comparisons across groups
The expression of many metal transporters is highly dynamic and can be regulated by the concentration of their respective substrates [ ]. In the absence of Slc39a14 expression,...
- Raw artifact
- Membrane or gel image with visible bands for target and control proteins
- Processed artifact
- Band quantification and normalized densitometry values
- Reported as
- Relative expression values or fold-change comparisons across groups
Slc39a14 is highly expressed in hepatocytes [ ]. Moreover, mutations in the human SLC39A14 gene have been suggested to affect Mn transport primarily in hepatocytes, thereby unde...
- Raw artifact
- Membrane or gel image with visible bands for target and control proteins
- Processed artifact
- Band quantification and normalized densitometry values
- Reported as
- Relative expression values or fold-change comparisons across groups
Analysis plan
How should the outputs become interpretable results?
Acquisition
Collect the raw assay or blot output and retain identifiers for each sample and experimental group.
inferred from protocolPreprocessing / cleaning
Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ].
from paperScoring or quantification
Quantify the primary readouts for this experiment: Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ]. Therefore, we used inductively coupled plasma mass spectrometry (ICP-M...; As early as 8 weeks of age, Slc39a14 -/- mice have brain Mn levels that are ~10-fold higher than age-matched wild-type control mice. We therefore tested whether the...; The expression of many metal transporters is highly dynamic and can be regulated by the concentration of their respective substrates [ ]. In the absence of Slc39a14 expression,...; Slc39a14 is highly expressed in hepatocytes [ ]. Moreover, mutations in the human SLC39A14 gene have been suggested to affect Mn transport primarily in hepatocytes, thereby unde....
from paperNormalization
Normalize expression or signal values against the stated control or loading reference before comparing groups.
inferred from protocolStatistical comparison
Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ]. Therefore, we used inductively coupled plasma mass spectrometry (ICP-M...; Interestingly, and consistent with the selective loss of Slc39a14 expression in the liver, hepatic Mn levels remained extremely low in the high Mn-fed Slc39a14 fl/fl;Alb-Cre +...; At least three independent experiments were used for statistical analyses. GraphPad Prism 5 software was used for statistical analyses, and all data passed the test for normalit...
from paperReporting output
Report representative outputs alongside summary comparisons for Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ]. Therefore, we used inductively coupled plasma mass spectrometry (ICP-M..., As early as 8 weeks of age, Slc39a14 -/- mice have brain Mn levels that are ~10-fold higher than age-matched wild-type control mice. We therefore tested whether the..., The expression of many metal transporters is highly dynamic and can be regulated by the concentration of their respective substrates [ ]. In the absence of Slc39a14 expression,..., Slc39a14 is highly expressed in hepatocytes [ ]. Moreover, mutations in the human SLC39A14 gene have been suggested to affect Mn transport primarily in hepatocytes, thereby unde....
inferred from protocolStructured statistical methods
Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ]. Therefore, we used inductively coupled plasma mass spectrometry (ICP-M...; Interestingly, and consistent with the selective loss of Slc39a14 expression in the liver, hepatic Mn levels remained extremely low in the high Mn-fed Slc39a14 fl/fl;Alb-Cre +...; At least three independent experiments were used for statistical analyses. GraphPad Prism 5 software was used for statistical analyses, and all data passed the test for normalit...
source structuredSource and audit
What supports the facts on this page?
Evidence quotes (6)
Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ]. Therefore, we used inductively coupled plasma mass spectrometry (ICP-MS) to measure the levels of various metals in Slc39a14 -/- and wild-type mice [,, ]. Interestingly, compared with age-matched wild-type controls, at 48 weeks of age the Slc39a14 -/- mice had significantly higher levels of Mn in a wide range of tissues, including the serum, brain, kidney, lung, heart and spleen ( ); Mn levels in the liver and intestine were similar between wild-type and Slc39a14 -/- mice. We found no significant differences between wild-type and Slc39a14 -/- mice with respect to Fe, Zn or Cu in any tissues ( ), with the exception of a slight yet significant increase in serum Fe levels ( ). Taken together, these data indicate that Slc39a14 is predominantly a Mn transporter.
As early as 8 weeks of age, Slc39a14 -/- mice have brain Mn levels that are ~10-fold higher than age-matched wild-type control mice. We therefore tested whether the effects of Mn accumulation could be reduced by treating mice with the metal chelator Na 2 CaEDTA. At 5 months of age, we treated wild-type and Slc39a14 -/- mice with Na 2 CaEDTA for 4 weeks using a standard therapeutic protocol [, ]. Chelation therapy had no effect on serum Mn levels ( ) or rotarod performance ( ) in wild-type mice; however, in Slc39a14 -/- mice, Na 2 CaEDTA treatment significantly reduced serum Mn levels (from 0.1 ng µl -1 to 0.05 ng µl -1; ) and significantly improved performance on the rotarod test ( ).
Given the systemic accumulation of Mn in Slc39a14 -/- mice, and that the liver is the primary storage site for Slc39a14-mediated Mn uptake in mice, we hypothesized that feeding hepatocyte-specific Slc39a14 fl/fl;Alb-Cre + mice a high Mn diet might increase their brain Mn levels. We therefore fed newly weaned Slc39a14 fl/fl;Alb-Cre + and control ( Slc39a14 fl/fl;Alb-Cre - ) mice a purified AIN-93G diet containing either a normal (10 p.p.m.) or high (2 400 p.p.m.) concentration of Mn [ ]. After 30 days on a high Mn diet, neither body weight ( ) nor rotarod performance ( ) differed between Slc39a14 fl/fl;Alb-Cre + and control mice; we also found no difference between mice fed a normal Mn diet and mice fed a high Mn diet (compare with, respectively). However, the high Mn diet increased serum Mn levels in both Slc39a14 fl/fl;Alb-Cre + and control mice, with a much stronger effect on the Slc39a14 fl/fl;Alb-Cre + mice ( ).
Control ( Slc39a14 fl/fl;Alb-Cre - ) and Slc39a14 fl/fl;Alb-Cre + mice were fed a purified AIN-93G diet containing either normal (10 p.p.m.) Mn (diet D08080401) or high (2 400 p.p.m.) Mn (diet D17020702) for 30 days. Based on a previous study, 2 400 p.p.m. of dietary Mn does not induce toxicity [ ]. During the 30-day feeding period, body weight, motor performance and ICP-MS metal analysis were performed as described above.
To analyze the animals' gait, we used the CatWalk XT system [ ] (Noldus Information Technology, Wageningen, The Netherlands). To measure the gait, the mouse was placed on a glass plate and allowed to walk along a narrow walkway, with a green light on the walkway and a red ceiling light to illuminate the mouse; a camera was used to record the mouse's paw placement while walking. During the test, the mouse was placed in an enclosed box at the end of the walkway and allowed to acclimate for 10 min, after which the lights were turned off, and the mouse was allowed to walk from the beginning of the walkway to the end of the walkway and enter the box. A successful trial was defined as the mouse taking ⩽10 s to cross the field of vision of a video camera that was used to capture the mouse's movement, which was analyzed by CatWalk XT software based on the mouse's limbs. Each mouse successfully completed three trials on each training day and two trials on the test day.
These methods were performed as previously described [,,, ]. Approximately 10-200 mg of each organ was placed in a 25-ml PFA vial with a screw cap and digested with 3.4 ml of concentrated EMSURE nitric acid solution (65%, 1.39 g ml -1, Merck, Darmstadt, Germany). The following microwave program was used for digestion: the temperature of the sample was ramped from room temperature to 200 degrees by microwaving at 1 000 W for 20 min; the microwave power was then held at 1 000 W for an additional 30 min, followed by a 15-min cooling step. The total digestion time was therefore 65 min. The digested samples were dried by heating and immediately diluted to a final volume of 5 ml in high-purity deionized water (18 MΩ cm -1 resistivity) obtained from a Milli-Q Integral 10 purification system (EMD Millipore Corporation, Darmstadt, Germany). Multi-element standard solutions containing Mn, Fe, Zn and Cu were prepared by diluting and mixing individual element standard stock solutions (1 000 µg ml -1 ) obtained from the National Institute of Quality Stan...
Machine-readable layer
[
{
"@context": "https://schema.org",
"@type": "HowTo",
"name": "Manganese transporter Slc39a14 deficiency revealed its key role in maintaining manganese homeostasis in mice methods",
"description": "Evidence-backed execution summary for Manganese transporter Slc39a14 deficiency revealed its key role in maintaining manganese homeostasis in mice methods from Manganese transporter Slc39a14 deficiency revealed its key role in maintaining manganese homeostasis in mice.",
"totalTime": "PT163200M",
"step": [
{
"@type": "HowToStep",
"position": 1,
"name": "Loss of Slc39a14 expression leads to Mn accumulation",
"text": "Slc39a14 has been reported to transport several metals, including Mn [ ], zinc (Zn) [ ] and iron (Fe) [ ]. Therefore, we used inductively coupled plasma mass spectrometry (ICP-MS) to measure the levels of various metals in Slc39a14 -/- and wild-type mice [,, ]. Interestingly, compared with age-matched wild-type controls, at 48 weeks of age the Slc39a14 -/- mice had significantly higher levels of Mn in a wide range of tissues, including the serum, brain, kidney, lung, heart and spleen ( ); Mn levels in the liver and intestine were similar between wild-type and Slc39a14 -/- mice. We found no significant differences between wild-type and Slc39a14 -/- mice with respect to Fe, Zn or Cu in any tissues ( ), with the exception of a slight yet significant increase in serum Fe levels ( ). Taken together, these data indicate that Slc39a14 is pred..."
},
{
"@type": "HowToStep",
"position": 2,
"name": "Loss of Slc39a14 expression leads to Mn accumulation",
"text": "As early as 8 weeks of age, Slc39a14 -/- mice have brain Mn levels that are ~10-fold higher than age-matched wild-type control mice. We therefore tested whether the effects of Mn accumulation could be reduced by treating mice with the metal chelator Na 2 CaEDTA. At 5 months of age, we treated wild-type and Slc39a14 -/- mice with Na 2 CaEDTA for 4 weeks using a standard therapeutic protocol [, ]. Chelation therapy had no effect on serum Mn levels ( ) or rotarod performance ( ) in wild-type mice; however, in Slc39a14 -/- mice, Na 2 CaEDTA treatment significantly reduced serum Mn levels (from 0.1 ng µl -1 to 0.05 ng µl -1; ) and significantly improved performance on the rotarod test ( )."
},
{
"@type": "HowToStep",
"position": 3,
"name": "High dietary Mn does not lead to hepatic Mn accumulation in hepatocyte-specific Slc39a14 -knockout mice",
"text": "Given the systemic accumulation of Mn in Slc39a14 -/- mice, and that the liver is the primary storage site for Slc39a14-mediated Mn uptake in mice, we hypothesized that feeding hepatocyte-specific Slc39a14 fl/fl;Alb-Cre + mice a high Mn diet might increase their brain Mn levels. We therefore fed newly weaned Slc39a14 fl/fl;Alb-Cre + and control ( Slc39a14 fl/fl;Alb-Cre - ) mice a purified AIN-93G diet containing either a normal (10 p.p.m.) or high (2 400 p.p.m.) concentration of Mn [ ]. After 30 days on a high Mn diet, neither body weight ( ) nor rotarod performance ( ) differed between Slc39a14 fl/fl;Alb-Cre + and control mice; we also found no difference between mice fed a normal Mn diet and mice fed a high Mn diet (compare with, respectively). However, the high Mn diet increased serum Mn levels in both Slc39a14 fl/fl;Alb-Cre + and control m..."
},
{
"@type": "HowToStep",
"position": 4,
"name": "Dietary Mn supplementation in hepatocyte-specific Slc39a14 -knockout mice",
"text": "Control ( Slc39a14 fl/fl;Alb-Cre - ) and Slc39a14 fl/fl;Alb-Cre + mice were fed a purified AIN-93G diet containing either normal (10 p.p.m.) Mn (diet D08080401) or high (2 400 p.p.m.) Mn (diet D17020702) for 30 days. Based on a previous study, 2 400 p.p.m. of dietary Mn does not induce toxicity [ ]. During the 30-day feeding period, body weight, motor performance and ICP-MS metal analysis were performed as described above."
},
{
"@type": "HowToStep",
"position": 5,
"name": "Behavioral testing",
"text": "To analyze the animals' gait, we used the CatWalk XT system [ ] (Noldus Information Technology, Wageningen, The Netherlands). To measure the gait, the mouse was placed on a glass plate and allowed to walk along a narrow walkway, with a green light on the walkway and a red ceiling light to illuminate the mouse; a camera was used to record the mouse's paw placement while walking. During the test, the mouse was placed in an enclosed box at the end of the walkway and allowed to acclimate for 10 min, after which the lights were turned off, and the mouse was allowed to walk from the beginning of the walkway to the end of the walkway and enter the box. A successful trial was defined as the mouse taking ⩽10 s to cross the field of vision of a video camera that was used to capture the mouse's movement, which was analyzed by CatWalk XT software based on the..."
},
{
"@type": "HowToStep",
"position": 6,
"name": "Laboratory measurements for ICP-MS detection",
"text": "These methods were performed as previously described [,,, ]. Approximately 10-200 mg of each organ was placed in a 25-ml PFA vial with a screw cap and digested with 3.4 ml of concentrated EMSURE nitric acid solution (65%, 1.39 g ml -1, Merck, Darmstadt, Germany). The following microwave program was used for digestion: the temperature of the sample was ramped from room temperature to 200 degrees by microwaving at 1 000 W for 20 min; the microwave power was then held at 1 000 W for an additional 30 min, followed by a 15-min cooling step. The total digestion time was therefore 65 min. The digested samples were dried by heating and immediately diluted to a final volume of 5 ml in high-purity deionized water (18 MΩ cm -1 resistivity) obtained from a Milli-Q Integral 10 purificatio..."
}
],
"tool": [
{
"@type": "HowToTool",
"name": "Loss of Slc39a14 expression leads to Mn accumulation"
},
{
"@type": "HowToTool",
"name": "High dietary Mn does not lead to hepatic Mn accumulation in hepatocyte-specific Slc39a14 -knockout mice"
},
{
"@type": "HowToTool",
"name": "Behavioral testing"
},
{
"@type": "HowToTool",
"name": "Behavioral testing"
},
{
"@type": "HowToTool",
"name": "Statistical analysis"
},
{
"@type": "HowToTool",
"name": "Behavioral testing"
},
{
"@type": "HowToTool",
"name": "Laboratory measurements for ICP-MS detection"
},
{
"@type": "HowToTool",
"name": "RNA extraction and qPCR analysis"
}
],
"supply": [
{
"@type": "HowToSupply",
"name": "Loss of Slc39a14 expression leads to Mn accumulation"
},
{
"@type": "HowToSupply",
"name": "Loss of Slc39a14 expression leads to Mn accumulation"
},
{
"@type": "HowToSupply",
"name": "High dietary Mn does not lead to hepatic Mn accumulation in hepatocyte-specific Slc39a14 -knockout mice"
},
{
"@type": "HowToSupply",
"name": "Animal genotyping"
},
{
"@type": "HowToSupply",
"name": "Laboratory measurements for ICP-MS detection"
},
{
"@type": "HowToSupply",
"name": "RNA extraction and qPCR analysis"
}
],
"isBasedOn": {
"@type": "ScholarlyArticle",
"headline": "Manganese transporter Slc39a14 deficiency revealed its key role in maintaining manganese homeostasis in mice",
"datePublished": "2017",
"author": [
{
"@type": "Person",
"name": "Yongjuan Xin"
},
{
"@type": "Person",
"name": "Hong Gao"
},
{
"@type": "Person",
"name": "Jia Wang"
},
{
"@type": "Person",
"name": "Yuzhen Qiang"
},
{
"@type": "Person",
"name": "Mustapha Umar Imam"
},
{
"@type": "Person",
"name": "Yang Li"
},
{
"@type": "Person",
"name": "Jianyao Wang"
},
{
"@type": "Person",
"name": "Ruochen Zhang"
},
{
"@type": "Person",
"name": "Huizhen Zhang"
},
{
"@type": "Person",
"name": "Yingying Yu"
},
{
"@type": "Person",
"name": "Hao Wang"
},
{
"@type": "Person",
"name": "Haiyang Luo"
},
{
"@type": "Person",
"name": "Changhe Shi"
},
{
"@type": "Person",
"name": "Yuming Xu"
},
{
"@type": "Person",
"name": "Shintaro Hojyo"
},
{
"@type": "Person",
"name": "Toshiyuki Fukada"
},
{
"@type": "Person",
"name": "Junxia Min"
},
{
"@type": "Person",
"name": "Fudi Wang"
}
],
"identifier": "10.1038/celldisc.2017.25"
}
},
{
"@context": "https://schema.org",
"@type": "BreadcrumbList",
"itemListElement": [
{
"@type": "ListItem",
"position": 1,
"name": "Experiments",
"item": "https://replicatescience.com/experiments"
},
{
"@type": "ListItem",
"position": 2,
"name": "Manganese transporter Slc39a14 deficiency revealed its key role in maintaining manganese homeostasis in mice methods",
"item": "https://replicatescience.com/experiments/manganese-transporter-slc39a14-deficiency-revealed-its-key-role-in-maintaining-manganese-homeostasis-in-mice-methods-yongjuan-xin-pmc5519003/manganese-transporter-slc39a14-deficiency-revealed-its-key-role-in-maintaining-manganese-homeostasis-mlph8r2u"
}
]
}
]