Role of the T cell in the genesis of angiotensin II-induced hypertension and vascular dysfunction methods
Aim. Evidence-backed execution summary for Role of the T cell in the genesis of angiotensin II-induced hypertension and vascular dysfunction methods from Role of the T cell in the genesis of angiotensin II-induced hypertension and vascular dysfunction.
Show snapshot details
On this page
This experiment, in seven questions
Jump straight to the part of the recipe you need. Data and provenance labels stay close to the action they support.
Shopping and prep list
What do I need before I start?
mouse
Subject model for the experiment.
- Use
- confirm full cohort details in the source paper
Vascular T cell infiltration in hypertension
reagent used in the protocol.
- Use
- T cell homing and vascular infiltration in response to angiotensin II-induced hypertension. (A) The percentage of circulating CD4 + lymphocytes expressing CCR5 and high levels of CD44, as determined by flow cytometric analysis ( n = 10). (B) Aortic mRNA expression of the CCR5 ligand RANTES, as determined by re...
Vascular T cell infiltration in hypertension
reagent used in the protocol.
- Use
- Characteristics of T cells infiltrating the aorta in response to angiotensin II-induced hypertension. (A) Examples of flow cytometric analysis of collagenase-digested cell suspensions of sham- and angiotensin II-infused mouse aortas. Fluorescent staining was performed to detect CD45 (total leukocytes) an...
Role of the NADPH oxidase in T cell activation caused by angiotensin II
reagent used in the protocol.
- Use
- As shown in, the T cell NADPH oxidase is necessary for full development of angiotensin II-induced hypertension. In keeping with this, we found that activation of T cells by angiotensin II was dependent on the NADPH oxidase. In vitro, incubation of T cells with angiotensin II alone had no effect on T cell acti...
Role of the NADPH oxidase in T cell activation caused by angiotensin II
reagent used in the protocol.
- Use
- Role of the T lymphocyte NADPH oxidase in modulating T cell activation, tissue homing, and blood pressure in response to angiotensin II. (A) Effect of 100 nM angiotensin II on the early activation marker CD69 in cultured T cells exposed to anti-CD3 ( n = 5). Parallel experiments were performed in the presence of the...
Effect of cytokine blockade on angiotensin II-induced hypertension
reagent used in the protocol.
- Use
- The T cell NADPH oxidase has recently been shown to affect cytokine production, which in turn might mediate hypertension and vascular dysfunction. Accordingly, we observed that T cell production of TNFα and IFNγ was increased after 2 wk of angiotensin II infusion in wild-type, but not in p47 phox -/&...
T and B cell separation.
reagent used in the protocol.
- Use
- For purified T or B cell separation, splenocytes or PBMC were isolated from donor mice and were purified using autoMACS and either a Pan T or B cell isolation kit (Miltenyi Biotech). Cell purity was confirmed to be ≥95%.
MATERIALS AND METHODS
reagent used in the protocol.
- Use
- C57BL/6, RAG-1 -/-, and AT1a -/- mice were obtained from Jackson ImmunoResearch Laboratories. The p47 phox -/- mice and their appropriate controls were obtained from Taconic. All experimental protocols were approved by the institutional Animal Care and Use Committee at Emory Univ...
Flow cytometry.
reagent used in the protocol.
- Use
- Spleens were removed and tissue-disrupted using forceps to release a single-cell suspension, which was passed through a 70-µm sterile strainer. Total blood leukocytes were isolated from the whole heparinized blood after osmotic lysis of excess red blood cells. Cells were centrifuged (800 g ), washed twice with...
Vascular T cell infiltration in hypertension
To gain insight into how T cells might contribute to hypertension and vascular dysfunction, we examined the effect of angiotensin II to promote vascular infiltration of T cells. We observed that the number of circulating CD4 + lymphocytes expressing the hyaluronan receptor CD44 and the chemokine receptor CCR5 was si...
- Use
- To gain insight into how T cells might contribute to hypertension and vascular dysfunction, we examined the effect of angiotensin II to promote vascular infiltration of T cells. We observed that the number of circulating CD4 + lymphocytes expressing the hyaluronan receptor CD44 and the chemokine receptor CCR5 was si...
Role of the NADPH oxidase in T cell activation caused by angiotensin II
Role of the T lymphocyte NADPH oxidase in modulating T cell activation, tissue homing, and blood pressure in response to angiotensin II. (A) Effect of 100 nM angiotensin II on the early activation marker CD69 in cultured T cells exposed to anti-CD3 ( n = 5). Parallel experiments were performed in the presence of the...
- Use
- Role of the T lymphocyte NADPH oxidase in modulating T cell activation, tissue homing, and blood pressure in response to angiotensin II. (A) Effect of 100 nM angiotensin II on the early activation marker CD69 in cultured T cells exposed to anti-CD3 ( n = 5). Parallel experiments were performed in the presence of the...
Flow cytometry.
Spleens were removed and tissue-disrupted using forceps to release a single-cell suspension, which was passed through a 70-µm sterile strainer. Total blood leukocytes were isolated from the whole heparinized blood after osmotic lysis of excess red blood cells. Cells were centrifuged (800 g ), washed twice with...
- Use
- Spleens were removed and tissue-disrupted using forceps to release a single-cell suspension, which was passed through a 70-µm sterile strainer. Total blood leukocytes were isolated from the whole heparinized blood after osmotic lysis of excess red blood cells. Cells were centrifuged (800 g ), washed twice with...
Flow cytometry.
After immunostaining, cells were resuspended in FACS buffer and analyzed immediately on a LSR-II flow cytometer with DIVA software (Becton Dickinson). Data were analyzed with FlowJo software (Tree Star, Inc.). T cells were analyzed as a percentage of the PBMC, and they were also expressed in absolute numbers.
- Use
- After immunostaining, cells were resuspended in FACS buffer and analyzed immediately on a LSR-II flow cytometer with DIVA software (Becton Dickinson). Data were analyzed with FlowJo software (Tree Star, Inc.). T cells were analyzed as a percentage of the PBMC, and they were also expressed in absolute numbers.
Analysis of leukocytes in vessels.
Mouse aortas were digested using collagenase type IX (125 U/ml), collagenase type IS (450 U/ml), and hyaluronidase IS (60 U/ml) dissolved in 20 mM Hepes-PBS buffer containing calcium and magnesium for 30 min at 37°C, with constant agitation. Aortas were then passed through a 70-µm sterile cell strainer (Fa...
- Use
- Mouse aortas were digested using collagenase type IX (125 U/ml), collagenase type IS (450 U/ml), and hyaluronidase IS (60 U/ml) dissolved in 20 mM Hepes-PBS buffer containing calcium and magnesium for 30 min at 37°C, with constant agitation. Aortas were then passed through a 70-µm sterile cell strainer (Fa...
Adoptive transfer of purified T or B cells.
Adoptive transfer was performed 3 wk before angiotensin II infusion. In preliminary studies, we found that longer delays after adoptive transfer had only minimal effect in either splenic or circulating T cell number. Total splenocytes were isolated from donor mice, and either T or B cells were isolated using cell-sp...
- Use
- Adoptive transfer was performed 3 wk before angiotensin II infusion. In preliminary studies, we found that longer delays after adoptive transfer had only minimal effect in either splenic or circulating T cell number. Total splenocytes were isolated from donor mice, and either T or B cells were isolated using cell-sp...
Immunohistochemistry and immunofluorescence.
For immunohistochemistry, mice were initially perfused with saline, and then with 10% formalin. After tissue processing, the aorta was embedded in paraffin. 5-µm sections of the aorta were prepared from the thoracic aorta segments 1 mm above the diaphragm. After deparafinization, antigen retrieval was performed...
- Use
- For immunohistochemistry, mice were initially perfused with saline, and then with 10% formalin. After tissue processing, the aorta was embedded in paraffin. 5-µm sections of the aorta were prepared from the thoracic aorta segments 1 mm above the diaphragm. After deparafinization, antigen retrieval was performed...
Vascular wall morphometry.
Aortic segments were obtained as described in Immunohistochemistry and immunofluorescence, and sections from 1 mm above the diaphragm were stained with hematoxylin and eosin and were analyzed using an Axioskop with an AxioCam system and AxioVision 4.6 software (all from Carl Zeiss MicroImaging, Inc.). Wall thickness...
- Use
- Aortic segments were obtained as described in Immunohistochemistry and immunofluorescence, and sections from 1 mm above the diaphragm were stained with hematoxylin and eosin and were analyzed using an Axioskop with an AxioCam system and AxioVision 4.6 software (all from Carl Zeiss MicroImaging, Inc.). Wall thickness...
Before you run
What should be confirmed before execution?
First confirmation
Equipment is listed but no product mappings are linked.
Confirm before execution
This page is backed by a publishable Replication Data Ledger package with zero critical source-verification issues.
Confirm before execution
Open the source paper before finalizing run-specific details.
Procurement checkpoint
Use source-stated vendors where present. Treat mapped products as sourcing options unless the page marks an exact source match.
Open quote workflowStep-by-step procedure
What do I do, in order?
Effect of cytokine blockade on angiotensin II-induced hypertension
Role of cytokines in blood pressure regulation and vascular O 2 ·- production. (A) Production of TNF-α (top) and IFN-γ (bottom) measured by cytometric bead array from anti-CD3-stimulated peripheral blood T cells isolated from C57BL/6 and p47 phox-/- mice infused with saline (sham) or angiotensin II for 14 d ( n = 8 in each group). (B) Anti-CD3-stimulated production of TNF-α from spleen-derived T cells in response to in vitro coincubation without (vehicle; n = 6) or with 100 nm angiotensin II (Ang II; n = 6). (C) Noninvasive blood pressure measurements at baseline and during angiotensin II infusion measured by tail cuff in mice injected IP with control IgG ( n = 4) or with anti-TNFα therapy (etanercept, ETA; 8 mg/kg; n = 6) 3 d before and every 3 d throughout the experiment. (D) Aortic O 2 ·- levels after angiotensin II...
MATERIALS AND METHODS
C57BL/6, RAG-1 -/-, and AT1a -/- mice were obtained from Jackson ImmunoResearch Laboratories. The p47 phox -/- mice and their appropriate controls were obtained from Taconic. All experimental protocols were approved by the institutional Animal Care and Use Committee at Emory University. All mice were on a C57BL/6 background. 490 ng/min/kg angiotensin II was infused and blood pressure was measured both invasively and noninvasively, as previously described ( ). Animals were maintained in a sterile environment and were regularly screened for infections. For adoptive transfer, mice were anesthetized with xylazine/ketamine and cells were injected via tail vein. Angiotensin II infusion and blood pressure monitoring was begun 3 wk after adoptive transfer. In some experiments, 8 mg/kg etanercept (AmGen) or a neutralizing IFNγ antibody (eBioscience; cl...
Flow cytometry.
Spleens were removed and tissue-disrupted using forceps to release a single-cell suspension, which was passed through a 70-µm sterile strainer. Total blood leukocytes were isolated from the whole heparinized blood after osmotic lysis of excess red blood cells. Cells were centrifuged (800 g ), washed twice with PBS and 0.5% BSA (FACS buffer), counted, resuspended in 1% BSA/PBS, and stored on ice for <30 min. Within 30 min, 10 6 cells were stained for 15 min at 4°C with antibodies and washed twice with FACS buffer. Antibodies used for staining, and in different multicolor combinations, are as follows: FITC anti-CD45 (30-F11); PerCP anti-CD45 (30-F11); APC anti-CD19 (1D3); PE anti-CD4 (GK1.5); APC anti-CD4 (GK1.5); FITC anti-CD4 (GK1.5); PerCP anti-CD8 (53-6.7); APC anti-CD3 (145-2C11); PE anti-I-Ab (AF6-120.1); FITC anti-I-Ab (AF6-120.1); APC anti-CD11b (HL3); APC CD11b...
Analysis of leukocytes in vessels.
Mouse aortas were digested using collagenase type IX (125 U/ml), collagenase type IS (450 U/ml), and hyaluronidase IS (60 U/ml) dissolved in 20 mM Hepes-PBS buffer containing calcium and magnesium for 30 min at 37°C, with constant agitation. Aortas were then passed through a 70-µm sterile cell strainer (Falcon; BD Biosciences), yielding single-cell suspensions. Cells were washed twice with 1% BSA PBS buffer and additionally incubated for 30 min in 37°C with complete media (RPMI; 10%FCS), then washed again, counted, and stained, using multicolor flow cytometry as described in the previous paragraph. An initial gate was applied to exclude cell debris from further analysis ( ), and CD45 staining was used to identify leukocytes within the aortic cell suspension. Within the CD45 + gate, T cells were identified with anti-CD3, -CD4, and -CD8 antibodies, as well as antibodies t...
Immunohistochemistry and immunofluorescence.
For immunohistochemistry, mice were initially perfused with saline, and then with 10% formalin. After tissue processing, the aorta was embedded in paraffin. 5-µm sections of the aorta were prepared from the thoracic aorta segments 1 mm above the diaphragm. After deparafinization, antigen retrieval was performed in citrate buffer, pH 6.0. Blocking was sequentially performed with 2% BSA, normal horse serum (Vector Laboratories), with avidin-biotin block (SP-2001; Vector Laboratories) and 1.5% hydrogen peroxide to remove endogenous peroxidase activity. Staining was performed using a rabbit polyclonal anti-CD3 zeta (Abcam; 1:100 dilution) as a primary antibody for 1 h at room temperature. After this, the sections were extensively washed and incubated for 45 min with a biotinylated secondary antibody from the ABC Vectastain system (PK-6101; Vector). Brown staining was visualized using...
Vascular wall morphometry.
Aortic segments were obtained as described in Immunohistochemistry and immunofluorescence, and sections from 1 mm above the diaphragm were stained with hematoxylin and eosin and were analyzed using an Axioskop with an AxioCam system and AxioVision 4.6 software (all from Carl Zeiss MicroImaging, Inc.). Wall thickness was measured from the internal to the external elastic lamina at 10 evenly spaced sites around the aorta. To determine total cross-sectional wall area, the internal and external elastic laminas were planimetered and their areas subtracted. This difference was reported as cross-sectional wall area.
In vitro effect of angiotensin II on T cell activation.
Spleen-derived T cells isolated by magnetic sorting as described above were suspended in RPMI 1640 with 25 mM Hepes, 1% FBS, 0.1% l -glutamine, and 0.1% penicillin/streptomycin, with or without 100 µM angiotensin II. Cells were plated at a density of 2 × 10 5 per well in 96-well plates precoated with anti-CD3 (BD Biosciences) and cultured for 3 h at 37°C with 5% CO 2. After incubation, cells were collected, washed with 1% BSA/PBS, and stained using anti-CD69-FITC, anti-CD4-APC, and anti-CD8-PerCP. FACS analysis was then performed using an LSR II (BD Biosciences) and FlowJo Software (Tree Star, Inc.).
In vitro effect of angiotensin II on T cell activation.
To analyze the effect of angiotensin II on cytokine production by isolated T lymphocytes, cells were plated at a density of 2 × 10 5 per well in 96-well plates precoated with anti-CD3 and cultured for 48 h at 37°C with 5% CO 2. After the incubation period, the media were collected and analyzed using the Cytometric Bead Array (BD Biosciences) to measure secreted TNF-α.
Measurement outputs
What raw and processed outputs should exist?
To gain insight into how T cells might contribute to hypertension and vascular dysfunction, we examined the effect of angiotensin II to promote vascular infiltration of T cells....
- Raw artifact
- Field or section images captured from matched samples
- Processed artifact
- Selected representative panels with quantified intensity, counts, or area measurements
- Reported as
- Per-group imaging summaries with representative figures and quantified endpoints
Aortic T cell infiltration was confirmed by real time PCR using specific primers to detect CD3 ε (forward, CGTCCGCCATCTTGGTAGAGAGAGCAT; reverse, CTACTGCTGTCAGGTCCACCTCCAC)....
- Raw artifact
- Field or section images captured from matched samples
- Processed artifact
- Selected representative panels with quantified intensity, counts, or area measurements
- Reported as
- Per-group imaging summaries with representative figures and quantified endpoints
T cell homing and vascular infiltration in response to angiotensin II-induced hypertension. (A) The percentage of circulating CD4 + lymphocytes expressing CCR5 and high le...
- Raw artifact
- Field or section images captured from matched samples
- Processed artifact
- Selected representative panels with quantified intensity, counts, or area measurements
- Reported as
- Per-group imaging summaries with representative figures and quantified endpoints
Characteristics of T cells infiltrating the aorta in response to angiotensin II-induced hypertension. (A) Examples of flow cytometric analysis of collagenase-digested cell...
- Raw artifact
- Field or section images captured from matched samples
- Processed artifact
- Selected representative panels with quantified intensity, counts, or area measurements
- Reported as
- Per-group imaging summaries with representative figures and quantified endpoints
Analysis plan
How should the outputs become interpretable results?
Acquisition
Capture matched images from the relevant tissue region using the same acquisition settings across samples.
inferred from protocolPreprocessing / cleaning
T cell homing and vascular infiltration in response to angiotensin II-induced hypertension.
from paperScoring or quantification
Quantify the primary readouts for this experiment: To gain insight into how T cells might contribute to hypertension and vascular dysfunction, we examined the effect of angiotensin II to promote vascular infiltration of T cells....; Aortic T cell infiltration was confirmed by real time PCR using specific primers to detect CD3 ε (forward, CGTCCGCCATCTTGGTAGAGAGAGCAT; reverse, CTACTGCTGTCAGGTCCACCTCCAC)....; T cell homing and vascular infiltration in response to angiotensin II-induced hypertension. (A) The percentage of circulating CD4 + lymphocytes expressing CCR5 and high le...; Characteristics of T cells infiltrating the aorta in response to angiotensin II-induced hypertension. (A) Examples of flow cytometric analysis of collagenase-digested cell....
from paperNormalization
Normalize image-derived measurements against the matched acquisition or segmentation rules before comparing groups.
inferred from protocolStatistical comparison
T cell homing and vascular infiltration in response to angiotensin II-induced hypertension. (A) The percentage of circulating CD4 + lymphocytes expressing CCR5 and high le...; Characteristics of T cells infiltrating the aorta in response to angiotensin II-induced hypertension. (A) Examples of flow cytometric analysis of collagenase-digested cell...; Role of the T lymphocyte NADPH oxidase in modulating T cell activation, tissue homing, and blood pressure in response to angiotensin II. (A) Effect of 100 nM angiotensin II on t...; The T cell NADPH oxidase has recently been shown to affect cytokine production, which in turn might mediate hypertension and vascular dysfunction. Accordingly, we observed that...
from paperReporting output
Report representative outputs alongside summary comparisons for To gain insight into how T cells might contribute to hypertension and vascular dysfunction, we examined the effect of angiotensin II to promote vascular infiltration of T cells...., Aortic T cell infiltration was confirmed by real time PCR using specific primers to detect CD3 ε (forward, CGTCCGCCATCTTGGTAGAGAGAGCAT; reverse, CTACTGCTGTCAGGTCCACCTCCAC)...., T cell homing and vascular infiltration in response to angiotensin II-induced hypertension. (A) The percentage of circulating CD4 + lymphocytes expressing CCR5 and high le..., Characteristics of T cells infiltrating the aorta in response to angiotensin II-induced hypertension. (A) Examples of flow cytometric analysis of collagenase-digested cell....
inferred from protocolStructured statistical methods
T cell homing and vascular infiltration in response to angiotensin II-induced hypertension. (A) The percentage of circulating CD4 + lymphocytes expressing CCR5 and high le...; Characteristics of T cells infiltrating the aorta in response to angiotensin II-induced hypertension. (A) Examples of flow cytometric analysis of collagenase-digested cell...; Role of the T lymphocyte NADPH oxidase in modulating T cell activation, tissue homing, and blood pressure in response to angiotensin II. (A) Effect of 100 nM angiotensin II on t...; The T cell NADPH oxidase has recently been shown to affect cytokine production, which in turn might mediate hypertension and vascular dysfunction. Accordingly, we observed that...
source structuredSource and audit
What supports the facts on this page?
Evidence quotes (8)
Role of cytokines in blood pressure regulation and vascular O 2 ·- production. (A) Production of TNF-α (top) and IFN-γ (bottom) measured by cytometric bead array from anti-CD3-stimulated peripheral blood T cells isolated from C57BL/6 and p47 phox-/- mice infused with saline (sham) or angiotensin II for 14 d ( n = 8 in each group). (B) Anti-CD3-stimulated production of TNF-α from spleen-derived T cells in response to in vitro coincubation without (vehicle; n = 6) or with 100 nm angiotensin II (Ang II; n = 6). (C) Noninvasive blood pressure measurements at baseline and during angiotensin II infusion measured by tail cuff in mice injected IP with control IgG ( n = 4) or with anti-TNFα therapy (etanercept, ETA; 8 mg/kg; n = 6) 3 d before and every 3 d throughout the experiment. (D) Aortic O 2 ·- levels after angiotensin II infusion in control mice or mice injected with etanercept ( n = 6) compared with sham-infused mice. In preliminary experiments, we showed that ETA did not directly inhibit contraction of vascular rings in response to angiotensin II. *, P < 0.05 vs. sham; ¶, P < 0.05 vs. α-CD3 + vehicle usi...
C57BL/6, RAG-1 -/-, and AT1a -/- mice were obtained from Jackson ImmunoResearch Laboratories. The p47 phox -/- mice and their appropriate controls were obtained from Taconic. All experimental protocols were approved by the institutional Animal Care and Use Committee at Emory University. All mice were on a C57BL/6 background. 490 ng/min/kg angiotensin II was infused and blood pressure was measured both invasively and noninvasively, as previously described ( ). Animals were maintained in a sterile environment and were regularly screened for infections. For adoptive transfer, mice were anesthetized with xylazine/ketamine and cells were injected via tail vein. Angiotensin II infusion and blood pressure monitoring was begun 3 wk after adoptive transfer. In some experiments, 8 mg/kg etanercept (AmGen) or a neutralizing IFNγ antibody (eBioscience; clone R4-6A2; 0.5 mg per injection per 30 g mouse) was administered i.p. 3 d before and every 3 d during angiotensin II infusion. In some mice, DOCA-salt hypertension was created as previously described, and studies were performed after 40 d from the induction of hypertension ( ).
Spleens were removed and tissue-disrupted using forceps to release a single-cell suspension, which was passed through a 70-µm sterile strainer. Total blood leukocytes were isolated from the whole heparinized blood after osmotic lysis of excess red blood cells. Cells were centrifuged (800 g ), washed twice with PBS and 0.5% BSA (FACS buffer), counted, resuspended in 1% BSA/PBS, and stored on ice for <30 min. Within 30 min, 10 6 cells were stained for 15 min at 4°C with antibodies and washed twice with FACS buffer. Antibodies used for staining, and in different multicolor combinations, are as follows: FITC anti-CD45 (30-F11); PerCP anti-CD45 (30-F11); APC anti-CD19 (1D3); PE anti-CD4 (GK1.5); APC anti-CD4 (GK1.5); FITC anti-CD4 (GK1.5); PerCP anti-CD8 (53-6.7); APC anti-CD3 (145-2C11); PE anti-I-Ab (AF6-120.1); FITC anti-I-Ab (AF6-120.1); APC anti-CD11b (HL3); APC CD11b (M1/70); PE 62L (MEL-14); PE CD25 (PC61); APC CD4 (RM4-5); PerCP CD4 (RM4-5); PE CCR5; FITC γ/δ (GL3); FITC Vβ7; FITC CD44 (IM7); FITC CD69 (H1.2F3); PE TcR β chain (H57-597); PE CD19 (1D3); and PE NK1.1 (PK136).
Mouse aortas were digested using collagenase type IX (125 U/ml), collagenase type IS (450 U/ml), and hyaluronidase IS (60 U/ml) dissolved in 20 mM Hepes-PBS buffer containing calcium and magnesium for 30 min at 37°C, with constant agitation. Aortas were then passed through a 70-µm sterile cell strainer (Falcon; BD Biosciences), yielding single-cell suspensions. Cells were washed twice with 1% BSA PBS buffer and additionally incubated for 30 min in 37°C with complete media (RPMI; 10%FCS), then washed again, counted, and stained, using multicolor flow cytometry as described in the previous paragraph. An initial gate was applied to exclude cell debris from further analysis ( ), and CD45 staining was used to identify leukocytes within the aortic cell suspension. Within the CD45 + gate, T cells were identified with anti-CD3, -CD4, and -CD8 antibodies, as well as antibodies to detect other supplementary surface molecules.
For immunohistochemistry, mice were initially perfused with saline, and then with 10% formalin. After tissue processing, the aorta was embedded in paraffin. 5-µm sections of the aorta were prepared from the thoracic aorta segments 1 mm above the diaphragm. After deparafinization, antigen retrieval was performed in citrate buffer, pH 6.0. Blocking was sequentially performed with 2% BSA, normal horse serum (Vector Laboratories), with avidin-biotin block (SP-2001; Vector Laboratories) and 1.5% hydrogen peroxide to remove endogenous peroxidase activity. Staining was performed using a rabbit polyclonal anti-CD3 zeta (Abcam; 1:100 dilution) as a primary antibody for 1 h at room temperature. After this, the sections were extensively washed and incubated for 45 min with a biotinylated secondary antibody from the ABC Vectastain system (PK-6101; Vector). Brown staining was visualized using 3,3′ diamino-benzidine tetrachloride (peroxidase substrate kit; SK-4100; Vector Labs). Immunofluorescence was performed on frozen 6-µm sections of the same region of the aorta using rat monoclonal anti-TCR (β chain) antibody (H57-597; BD Biosciences; 1:100). A PE-conjugated antibody...
Aortic segments were obtained as described in Immunohistochemistry and immunofluorescence, and sections from 1 mm above the diaphragm were stained with hematoxylin and eosin and were analyzed using an Axioskop with an AxioCam system and AxioVision 4.6 software (all from Carl Zeiss MicroImaging, Inc.). Wall thickness was measured from the internal to the external elastic lamina at 10 evenly spaced sites around the aorta. To determine total cross-sectional wall area, the internal and external elastic laminas were planimetered and their areas subtracted. This difference was reported as cross-sectional wall area.
Spleen-derived T cells isolated by magnetic sorting as described above were suspended in RPMI 1640 with 25 mM Hepes, 1% FBS, 0.1% l -glutamine, and 0.1% penicillin/streptomycin, with or without 100 µM angiotensin II. Cells were plated at a density of 2 × 10 5 per well in 96-well plates precoated with anti-CD3 (BD Biosciences) and cultured for 3 h at 37°C with 5% CO 2. After incubation, cells were collected, washed with 1% BSA/PBS, and stained using anti-CD69-FITC, anti-CD4-APC, and anti-CD8-PerCP. FACS analysis was then performed using an LSR II (BD Biosciences) and FlowJo Software (Tree Star, Inc.).
To analyze the effect of angiotensin II on cytokine production by isolated T lymphocytes, cells were plated at a density of 2 × 10 5 per well in 96-well plates precoated with anti-CD3 and cultured for 48 h at 37°C with 5% CO 2. After the incubation period, the media were collected and analyzed using the Cytometric Bead Array (BD Biosciences) to measure secreted TNF-α.
Machine-readable layer
[
{
"@context": "https://schema.org",
"@type": "HowTo",
"name": "Role of the T cell in the genesis of angiotensin II-induced hypertension and vascular dysfunction methods",
"description": "Evidence-backed execution summary for Role of the T cell in the genesis of angiotensin II-induced hypertension and vascular dysfunction methods from Role of the T cell in the genesis of angiotensin II-induced hypertension and vascular dysfunction.",
"totalTime": "PT105M",
"step": [
{
"@type": "HowToStep",
"position": 1,
"name": "Effect of cytokine blockade on angiotensin II-induced hypertension",
"text": "Role of cytokines in blood pressure regulation and vascular O 2 ·- production. (A) Production of TNF-α (top) and IFN-γ (bottom) measured by cytometric bead array from anti-CD3-stimulated peripheral blood T cells isolated from C57BL/6 and p47 phox-/- mice infused with saline (sham) or angiotensin II for 14 d ( n = 8 in each group). (B) Anti-CD3-stimulated production of TNF-α from spleen-derived T cells in response to in vitro coincubation without (vehicle; n = 6) or with 100 nm angiotensin II (Ang II; n = 6). (C) Noninvasive blood pressure measurements at baseline and during angiotensin II infusion measured by tail cuff in mice injected IP with control IgG ( n = 4) or with anti-TNFα therapy (etanercept, ETA; 8 mg/kg; n = 6) 3 d before and every 3 d throughout the experiment. (D) Aortic O 2 ·- levels after angiotensin II..."
},
{
"@type": "HowToStep",
"position": 2,
"name": "MATERIALS AND METHODS",
"text": "C57BL/6, RAG-1 -/-, and AT1a -/- mice were obtained from Jackson ImmunoResearch Laboratories. The p47 phox -/- mice and their appropriate controls were obtained from Taconic. All experimental protocols were approved by the institutional Animal Care and Use Committee at Emory University. All mice were on a C57BL/6 background. 490 ng/min/kg angiotensin II was infused and blood pressure was measured both invasively and noninvasively, as previously described ( ). Animals were maintained in a sterile environment and were regularly screened for infections. For adoptive transfer, mice were anesthetized with xylazine/ketamine and cells were injected via tail vein. Angiotensin II infusion and blood pressure monitoring was begun 3 wk after adoptive transfer. In some experiments, 8 mg/kg etanercept (AmGen) or a neutralizing IFNγ antibody (eBioscience; cl..."
},
{
"@type": "HowToStep",
"position": 3,
"name": "Flow cytometry.",
"text": "Spleens were removed and tissue-disrupted using forceps to release a single-cell suspension, which was passed through a 70-µm sterile strainer. Total blood leukocytes were isolated from the whole heparinized blood after osmotic lysis of excess red blood cells. Cells were centrifuged (800 g ), washed twice with PBS and 0.5% BSA (FACS buffer), counted, resuspended in 1% BSA/PBS, and stored on ice for <30 min. Within 30 min, 10 6 cells were stained for 15 min at 4°C with antibodies and washed twice with FACS buffer. Antibodies used for staining, and in different multicolor combinations, are as follows: FITC anti-CD45 (30-F11); PerCP anti-CD45 (30-F11); APC anti-CD19 (1D3); PE anti-CD4 (GK1.5); APC anti-CD4 (GK1.5); FITC anti-CD4 (GK1.5); PerCP anti-CD8 (53-6.7); APC anti-CD3 (145-2C11); PE anti-I-Ab (AF6-120.1); FITC anti-I-Ab (AF6-120.1); APC anti-CD11b (HL3); APC CD11b..."
},
{
"@type": "HowToStep",
"position": 4,
"name": "Analysis of leukocytes in vessels.",
"text": "Mouse aortas were digested using collagenase type IX (125 U/ml), collagenase type IS (450 U/ml), and hyaluronidase IS (60 U/ml) dissolved in 20 mM Hepes-PBS buffer containing calcium and magnesium for 30 min at 37°C, with constant agitation. Aortas were then passed through a 70-µm sterile cell strainer (Falcon; BD Biosciences), yielding single-cell suspensions. Cells were washed twice with 1% BSA PBS buffer and additionally incubated for 30 min in 37°C with complete media (RPMI; 10%FCS), then washed again, counted, and stained, using multicolor flow cytometry as described in the previous paragraph. An initial gate was applied to exclude cell debris from further analysis ( ), and CD45 staining was used to identify leukocytes within the aortic cell suspension. Within the CD45 + gate, T cells were identified with anti-CD3, -CD4, and -CD8 antibodies, as well as antibodies t..."
},
{
"@type": "HowToStep",
"position": 5,
"name": "Immunohistochemistry and immunofluorescence.",
"text": "For immunohistochemistry, mice were initially perfused with saline, and then with 10% formalin. After tissue processing, the aorta was embedded in paraffin. 5-µm sections of the aorta were prepared from the thoracic aorta segments 1 mm above the diaphragm. After deparafinization, antigen retrieval was performed in citrate buffer, pH 6.0. Blocking was sequentially performed with 2% BSA, normal horse serum (Vector Laboratories), with avidin-biotin block (SP-2001; Vector Laboratories) and 1.5% hydrogen peroxide to remove endogenous peroxidase activity. Staining was performed using a rabbit polyclonal anti-CD3 zeta (Abcam; 1:100 dilution) as a primary antibody for 1 h at room temperature. After this, the sections were extensively washed and incubated for 45 min with a biotinylated secondary antibody from the ABC Vectastain system (PK-6101; Vector). Brown staining was visualized using..."
},
{
"@type": "HowToStep",
"position": 6,
"name": "Vascular wall morphometry.",
"text": "Aortic segments were obtained as described in Immunohistochemistry and immunofluorescence, and sections from 1 mm above the diaphragm were stained with hematoxylin and eosin and were analyzed using an Axioskop with an AxioCam system and AxioVision 4.6 software (all from Carl Zeiss MicroImaging, Inc.). Wall thickness was measured from the internal to the external elastic lamina at 10 evenly spaced sites around the aorta. To determine total cross-sectional wall area, the internal and external elastic laminas were planimetered and their areas subtracted. This difference was reported as cross-sectional wall area."
},
{
"@type": "HowToStep",
"position": 7,
"name": "In vitro effect of angiotensin II on T cell activation.",
"text": "Spleen-derived T cells isolated by magnetic sorting as described above were suspended in RPMI 1640 with 25 mM Hepes, 1% FBS, 0.1% l -glutamine, and 0.1% penicillin/streptomycin, with or without 100 µM angiotensin II. Cells were plated at a density of 2 × 10 5 per well in 96-well plates precoated with anti-CD3 (BD Biosciences) and cultured for 3 h at 37°C with 5% CO 2. After incubation, cells were collected, washed with 1% BSA/PBS, and stained using anti-CD69-FITC, anti-CD4-APC, and anti-CD8-PerCP. FACS analysis was then performed using an LSR II (BD Biosciences) and FlowJo Software (Tree Star, Inc.)."
},
{
"@type": "HowToStep",
"position": 8,
"name": "In vitro effect of angiotensin II on T cell activation.",
"text": "To analyze the effect of angiotensin II on cytokine production by isolated T lymphocytes, cells were plated at a density of 2 × 10 5 per well in 96-well plates precoated with anti-CD3 and cultured for 48 h at 37°C with 5% CO 2. After the incubation period, the media were collected and analyzed using the Cytometric Bead Array (BD Biosciences) to measure secreted TNF-α."
}
],
"tool": [
{
"@type": "HowToTool",
"name": "Vascular T cell infiltration in hypertension"
},
{
"@type": "HowToTool",
"name": "Role of the NADPH oxidase in T cell activation caused by angiotensin II"
},
{
"@type": "HowToTool",
"name": "Flow cytometry."
},
{
"@type": "HowToTool",
"name": "Flow cytometry."
},
{
"@type": "HowToTool",
"name": "Analysis of leukocytes in vessels."
},
{
"@type": "HowToTool",
"name": "Adoptive transfer of purified T or B cells."
},
{
"@type": "HowToTool",
"name": "Immunohistochemistry and immunofluorescence."
},
{
"@type": "HowToTool",
"name": "Vascular wall morphometry."
}
],
"supply": [
{
"@type": "HowToSupply",
"name": "Vascular T cell infiltration in hypertension"
},
{
"@type": "HowToSupply",
"name": "Vascular T cell infiltration in hypertension"
},
{
"@type": "HowToSupply",
"name": "Role of the NADPH oxidase in T cell activation caused by angiotensin II"
},
{
"@type": "HowToSupply",
"name": "Role of the NADPH oxidase in T cell activation caused by angiotensin II"
},
{
"@type": "HowToSupply",
"name": "Effect of cytokine blockade on angiotensin II-induced hypertension"
},
{
"@type": "HowToSupply",
"name": "T and B cell separation."
},
{
"@type": "HowToSupply",
"name": "MATERIALS AND METHODS"
},
{
"@type": "HowToSupply",
"name": "Flow cytometry."
}
],
"isBasedOn": {
"@type": "ScholarlyArticle",
"headline": "Role of the T cell in the genesis of angiotensin II-induced hypertension and vascular dysfunction",
"datePublished": "2007",
"author": [
{
"@type": "Person",
"name": "Tomasz J. Guzik"
},
{
"@type": "Person",
"name": "Nyssa E. Hoch"
},
{
"@type": "Person",
"name": "Kathryn A. Brown"
},
{
"@type": "Person",
"name": "Louise A. McCann"
},
{
"@type": "Person",
"name": "Ayaz Rahman"
},
{
"@type": "Person",
"name": "Sergey Dikalov"
},
{
"@type": "Person",
"name": "Jorg Goronzy"
},
{
"@type": "Person",
"name": "Cornelia Weyand"
},
{
"@type": "Person",
"name": "David G. Harrison"
}
],
"identifier": "10.1084/jem.20070657"
}
},
{
"@context": "https://schema.org",
"@type": "BreadcrumbList",
"itemListElement": [
{
"@type": "ListItem",
"position": 1,
"name": "Experiments",
"item": "https://replicatescience.com/experiments"
},
{
"@type": "ListItem",
"position": 2,
"name": "Role of the T cell in the genesis of angiotensin II-induced hypertension and vascular dysfunction methods",
"item": "https://replicatescience.com/experiments/role-of-the-t-cell-in-the-genesis-of-angiotensin-ii-8211-induced-hypertension-and-vascular-dysfunction-methods-tomasz-j-guzik-pmc2118469/role-of-the-t-cell-in-the-genesis-of-angiotensin-ii-induced-hypertension-and-vascular-dysfunction-mlph16e7"
}
]
}
]