Spatial Relational Memory Requires Hippocampal Adult Neurogenesis methods
Aim. Evidence-backed execution summary for Spatial Relational Memory Requires Hippocampal Adult Neurogenesis methods from Spatial Relational Memory Requires Hippocampal Adult Neurogenesis.
Show snapshot details
On this page
This experiment, in seven questions
Jump straight to the part of the recipe you need. Data and provenance labels stay close to the action they support.
Shopping and prep list
What do I need before I start?
mouse
Subject model for the experiment.
- Use
- confirm full cohort details in the source paper
Materials and Methods
reagent used in the protocol.
- Use
- Forward primer: 5′ ACGC GTCGAC GACTGAGAACTTCAGGGTGAGTTTGG 3′ /Reverse primer: 5′ CTTT GACCAGCGTC ATGCAGTCGAGTTCATAAGAGAAGAGG 3′. A Sal I restriction site in 5′ (underlined) and a PshAI restriction site in 3′ (underlined) were added in the forward and the reverse primer, respectiv...
Hippocampal inactivation
reagent used in the protocol.
- Use
- In order to verify the hippocampal dependency of our fear conditioning procedure, supplementary groups of C57BL/6J male animals (n = 13) were implanted with bilateral hippocampal cannulae, and were injected with either lidocaine or vehicle solutions just before the conditioning session. Stainless-steel g...
Immunohistochemistry
reagent used in the protocol.
- Use
- At the end of experiments, mice were perfused transcardially with a phosphate-buffered solution of 4% paraformaldehyde and brains were cut on a vibratome (40 µm thick sections). For each staining, one in ten free-floating sections was processed according to a standard immunohistochemical procedure. HH3 immunor...
Inhibition of adult hippocampal neurogenesis alters spatial relational memory
Spatial navigation was studied using the water maze in which animals learn the location of a hidden platform using distal cues. This task can be solved using multiple strategies in parallel, which requires the integrity of the hippocampus to different degrees,. The strategies that the animals develop depend on the...
- Use
- Spatial navigation was studied using the water maze in which animals learn the location of a hidden platform using distal cues. This task can be solved using multiple strategies in parallel, which requires the integrity of the hippocampus to different degrees,. The strategies that the animals develop depend on the...
Inhibition of adult hippocampal neurogenesis alters spatial relational memory
In the second hippocampal-independent procedure ( ) the platform was also hidden from the beginning of training but the starting point was maintained constant for all trials. In this case, although the development of a mapping strategy is not prevented, the animal can also learn the position of the platform using eg...
- Use
- In the second hippocampal-independent procedure ( ) the platform was also hidden from the beginning of training but the starting point was maintained constant for all trials. In this case, although the development of a mapping strategy is not prevented, the animal can also learn the position of the platform using eg...
Discussion
Expression of Bax fusion proteins, activation of caspase-3, as well as cell genesis and neurogenesis were not modified by Dox treatment in the SVZ-OB system, the second main neurogenic area of the adult brain. Furthermore, in other brain areas, such as the cerebellum, the cortex or the striatum neither the expressio...
- Use
- Expression of Bax fusion proteins, activation of caspase-3, as well as cell genesis and neurogenesis were not modified by Dox treatment in the SVZ-OB system, the second main neurogenic area of the adult brain. Furthermore, in other brain areas, such as the cerebellum, the cortex or the striatum neither the expressio...
Adult-born neurons influence spatial relational memory
The lack of impairment in contextual fear conditioning after inhibition of neurogenesis that we described here is consistent with some but not all previous studies -. Data concerning the water maze are more conflicting given that neurogenesis inhibition did not influence performances in this task in most stud...
- Use
- The lack of impairment in contextual fear conditioning after inhibition of neurogenesis that we described here is consistent with some but not all previous studies -. Data concerning the water maze are more conflicting given that neurogenesis inhibition did not influence performances in this task in most stud...
Fluorescence Resonance Energy Transfer
FRET analysis of Bax multimers was used to track the intermolecular interaction between ECFPBax and EYFPBax fusion proteins. For cultured CHO cells, FRET was quantified using "Microfret". In brief, this method consists in the acquisition of three images through i) a CFP filter set (excitation 436/10 nm,...
- Use
- FRET analysis of Bax multimers was used to track the intermolecular interaction between ECFPBax and EYFPBax fusion proteins. For cultured CHO cells, FRET was quantified using "Microfret". In brief, this method consists in the acquisition of three images through i) a CFP filter set (excitation 436/10 nm,...
Behavioral analysis
At 14 weeks of age, 6 weeks after the beginning of the Dox treatment, independent groups of mice were tested in two separate experiments (experiments 2 and 3) for three behavioral tasks, each task being separated by a one week interval. The order of the tasks in the two experiments was changed in order to control fo...
- Use
- At 14 weeks of age, 6 weeks after the beginning of the Dox treatment, independent groups of mice were tested in two separate experiments (experiments 2 and 3) for three behavioral tasks, each task being separated by a one week interval. The order of the tasks in the two experiments was changed in order to control fo...
Training with constant start positions
During this test mice were also required to locate the hidden platform using distal extra-maze cues. Procedures were similar to the ones used for training with variable start positions (3 daily trials with a 60 seconds cut-off and 5 min inter-trial intervals). However this time the start position was maintained cons...
- Use
- During this test mice were also required to locate the hidden platform using distal extra-maze cues. Procedures were similar to the ones used for training with variable start positions (3 daily trials with a 60 seconds cut-off and 5 min inter-trial intervals). However this time the start position was maintained cons...
Stereological analysis
The number of X-IR cells was counted under a 100 × microscope objective. The total number of X-IR cells in the granular and subgranular layers of the DG was estimated using a modified version of the optical fractionator method on a systematic random sampling of every tenth section along the rostro-caudal axis of...
- Use
- The number of X-IR cells was counted under a 100 × microscope objective. The total number of X-IR cells in the granular and subgranular layers of the DG was estimated using a modified version of the optical fractionator method on a systematic random sampling of every tenth section along the rostro-caudal axis of...
Before you run
What should be confirmed before execution?
First confirmation
Equipment is listed but no product mappings are linked.
Confirm before execution
This page is backed by a publishable Replication Data Ledger package with zero critical source-verification issues.
Confirm before execution
Open the source paper before finalizing run-specific details.
Procurement checkpoint
Use source-stated vendors where present. Treat mapped products as sourcing options unless the page marks an exact source match.
Open quote workflowStep-by-step procedure
What do I do, in order?
Fluorescence Resonance Energy Transfer
FRET analysis of Bax multimers was used to track the intermolecular interaction between ECFPBax and EYFPBax fusion proteins. For cultured CHO cells, FRET was quantified using "Microfret". In brief, this method consists in the acquisition of three images through i) a CFP filter set (excitation 436/10 nm, emission 470/30 nm); ii) a YFP filter set (excitation 500/20 nm, emission 535/30 nm); iii) a FRET filter set (excitation 436/10 nm, emission 535/30 nm), and the determination of the "corrected FRET" or FRETc value which takes into consideration the non-FRET signal caused by the overlapping of the CFP and YFP spectra. Thus, the calculation of FRETc depends on the following relationship: FRETc = IFRET-CCFP-CYFP, where IFRET corresponds to the intensity of FRET with the FRET filter set of CFP/YFP-coexpressing cells; CCFP and CYFP correspond...
Behavioral analysis
At 14 weeks of age, 6 weeks after the beginning of the Dox treatment, independent groups of mice were tested in two separate experiments (experiments 2 and 3) for three behavioral tasks, each task being separated by a one week interval. The order of the tasks in the two experiments was changed in order to control for the possible bias due to interactions between tasks or treatment duration ( ). In experiment 2, novel environment exploration was tested twice, the first time at the beginning and the second time at the end of the behavioral sequence. Animals were then tested in a water maze followed by a fear conditioning test. In experiment 3 the opposite sequence was used. During water maze testing, in experiment 2 animals were first trained with a variable starting-point procedure, followed by a probe test, a visible platform test, and then by a constant starting point procedure befor...
Training with constant start positions
During this test mice were also required to locate the hidden platform using distal extra-maze cues. Procedures were similar to the ones used for training with variable start positions (3 daily trials with a 60 seconds cut-off and 5 min inter-trial intervals). However this time the start position was maintained constant between trials and days of training. Also the hidden platform was localized in a different quadrant than the one used for the variable-start paradigm. When performances reached a criterion of less than 10 sec of escape latency over two successive trials (2 nd day of training in experiment 2; 8 th day of training in experiment 3), animals were tested to locate the hidden platform from a novel start position that had never been used before (1 trial with a 60 seconds cut-off).
Hippocampal inactivation
In order to verify the hippocampal dependency of our fear conditioning procedure, supplementary groups of C57BL/6J male animals (n = 13) were implanted with bilateral hippocampal cannulae, and were injected with either lidocaine or vehicle solutions just before the conditioning session. Stainless-steel guided cannulae (26 gauge, 8 mm in length) were implanted bilaterally 1 mm above the dorsal hippocampus (A/P, -2000 µm; M/L, ±1300 µm; D/V, 1000 µm). Guides were permanently fixed to the skull with dental cement and two jewel screws and were obturated by appropriate stylets until behavioral manipulations. After surgery, mice were allowed to recover for at least 2 weeks. For infusions, the stylets obtruding the guide cannulae were removed. Stainless-steel cannulae (32 gauge, 9 mm) attached to 1 µl Hamilton syringes (PolyLabo, Strasbourg, France)...
Immunohistochemistry
At the end of experiments, mice were perfused transcardially with a phosphate-buffered solution of 4% paraformaldehyde and brains were cut on a vibratome (40 µm thick sections). For each staining, one in ten free-floating sections was processed according to a standard immunohistochemical procedure. HH3 immunoreactivity (IR), nestin-IR, activated caspase 3-IR, Dcx-IR, CD11b-IR or PECAM-1-IR were revealed using respectively a rabbit anti-HH3 polyclonal antibody (1∶2000, Upstate), a mouse anti-nestin monoclonal antibody (1∶1000; Chemicon), a rabbit anti-activated caspase 3 polyclonal antibody (1:500, Cell signaling technology), a sheep anti-Dcx polyclonal antibody (1∶2000; SantaCruz), a rat anti-mouse CD11b monoclonal antibody (1∶1000; Serotec) and a rat anti-mouse PECAM-1 monoclonal antibody (1:500; Pharmingen). For BrdU labeling, sections were treated with...
Measurement outputs
What raw and processed outputs should exist?
In the second hippocampal-independent procedure ( ) the platform was also hidden from the beginning of training but the starting point was maintained constant for all trials. In...
- Raw artifact
- Field or section images captured from matched samples
- Processed artifact
- Selected representative panels with quantified intensity, counts, or area measurements
- Reported as
- Per-group imaging summaries with representative figures and quantified endpoints
Inhibition of neurogenesis impaired spatial relational memory. Indeed, when submitted to the variable starting point procedure, bigenic-Dox mice were profoundly impaired in lear...
- Raw artifact
- Field or section images captured from matched samples
- Processed artifact
- Selected representative panels with quantified intensity, counts, or area measurements
- Reported as
- Per-group imaging summaries with representative figures and quantified endpoints
In contrast, inhibition of neurogenesis did not influence learning when the hippocampal-independent procedure was used. Thus, when animals were trained with a constant starting...
- Raw artifact
- Field or section images captured from matched samples
- Processed artifact
- Selected representative panels with quantified intensity, counts, or area measurements
- Reported as
- Per-group imaging summaries with representative figures and quantified endpoints
Expression of Bax fusion proteins, activation of caspase-3, as well as cell genesis and neurogenesis were not modified by Dox treatment in the SVZ-OB system, the second main neu...
- Raw artifact
- Membrane or gel image with visible bands for target and control proteins
- Processed artifact
- Band quantification and normalized densitometry values
- Reported as
- Relative expression values or fold-change comparisons across groups
Analysis plan
How should the outputs become interpretable results?
Acquisition
Capture matched images from the relevant tissue region using the same acquisition settings across samples.
inferred from protocolPreprocessing / cleaning
Inhibition of neurogenesis impaired spatial relational memory.
from paperScoring or quantification
Quantify the primary readouts for this experiment: In the second hippocampal-independent procedure ( ) the platform was also hidden from the beginning of training but the starting point was maintained constant for all trials. In...; Inhibition of neurogenesis impaired spatial relational memory. Indeed, when submitted to the variable starting point procedure, bigenic-Dox mice were profoundly impaired in lear...; In contrast, inhibition of neurogenesis did not influence learning when the hippocampal-independent procedure was used. Thus, when animals were trained with a constant starting...; Expression of Bax fusion proteins, activation of caspase-3, as well as cell genesis and neurogenesis were not modified by Dox treatment in the SVZ-OB system, the second main neu....
from paperNormalization
Normalize image-derived measurements against the matched acquisition or segmentation rules before comparing groups.
inferred from protocolStatistical comparison
Inhibition of neurogenesis impaired spatial relational memory. Indeed, when submitted to the variable starting point procedure, bigenic-Dox mice were profoundly impaired in lear...; In contrast, inhibition of neurogenesis did not influence learning when the hippocampal-independent procedure was used. Thus, when animals were trained with a constant starting...
from paperReporting output
Report representative outputs alongside summary comparisons for In the second hippocampal-independent procedure ( ) the platform was also hidden from the beginning of training but the starting point was maintained constant for all trials. In..., Inhibition of neurogenesis impaired spatial relational memory. Indeed, when submitted to the variable starting point procedure, bigenic-Dox mice were profoundly impaired in lear..., In contrast, inhibition of neurogenesis did not influence learning when the hippocampal-independent procedure was used. Thus, when animals were trained with a constant starting..., Expression of Bax fusion proteins, activation of caspase-3, as well as cell genesis and neurogenesis were not modified by Dox treatment in the SVZ-OB system, the second main neu....
inferred from protocolStructured statistical methods
Inhibition of neurogenesis impaired spatial relational memory. Indeed, when submitted to the variable starting point procedure, bigenic-Dox mice were profoundly impaired in lear...; In contrast, inhibition of neurogenesis did not influence learning when the hippocampal-independent procedure was used. Thus, when animals were trained with a constant starting...
source structuredSource and audit
What supports the facts on this page?
Evidence quotes (5)
FRET analysis of Bax multimers was used to track the intermolecular interaction between ECFPBax and EYFPBax fusion proteins. For cultured CHO cells, FRET was quantified using "Microfret". In brief, this method consists in the acquisition of three images through i) a CFP filter set (excitation 436/10 nm, emission 470/30 nm); ii) a YFP filter set (excitation 500/20 nm, emission 535/30 nm); iii) a FRET filter set (excitation 436/10 nm, emission 535/30 nm), and the determination of the "corrected FRET" or FRETc value which takes into consideration the non-FRET signal caused by the overlapping of the CFP and YFP spectra. Thus, the calculation of FRETc depends on the following relationship: FRETc = IFRET-CCFP-CYFP, where IFRET corresponds to the intensity of FRET with the FRET filter set of CFP/YFP-coexpressing cells; CCFP and CYFP correspond respectively to the crosstalk between CFP and YFP due to overlapping spectra. This phenomenon was evaluated in cells expressing only one of the two constructs, because the contribution of CFP and YFP to FRET in coexpressed cells is proportional to that in singly expressed cells. The right side of t...
At 14 weeks of age, 6 weeks after the beginning of the Dox treatment, independent groups of mice were tested in two separate experiments (experiments 2 and 3) for three behavioral tasks, each task being separated by a one week interval. The order of the tasks in the two experiments was changed in order to control for the possible bias due to interactions between tasks or treatment duration ( ). In experiment 2, novel environment exploration was tested twice, the first time at the beginning and the second time at the end of the behavioral sequence. Animals were then tested in a water maze followed by a fear conditioning test. In experiment 3 the opposite sequence was used. During water maze testing, in experiment 2 animals were first trained with a variable starting-point procedure, followed by a probe test, a visible platform test, and then by a constant starting point procedure before finally testing them with a novel start point. In experiment 3 the inverse order of water maze paradigms was used: animals were first trained with a constant starting-point procedure followed by testing with a novel starting point, and then a variable starting point procedure followed by a probe t...
During this test mice were also required to locate the hidden platform using distal extra-maze cues. Procedures were similar to the ones used for training with variable start positions (3 daily trials with a 60 seconds cut-off and 5 min inter-trial intervals). However this time the start position was maintained constant between trials and days of training. Also the hidden platform was localized in a different quadrant than the one used for the variable-start paradigm. When performances reached a criterion of less than 10 sec of escape latency over two successive trials (2 nd day of training in experiment 2; 8 th day of training in experiment 3), animals were tested to locate the hidden platform from a novel start position that had never been used before (1 trial with a 60 seconds cut-off).
In order to verify the hippocampal dependency of our fear conditioning procedure, supplementary groups of C57BL/6J male animals (n = 13) were implanted with bilateral hippocampal cannulae, and were injected with either lidocaine or vehicle solutions just before the conditioning session. Stainless-steel guided cannulae (26 gauge, 8 mm in length) were implanted bilaterally 1 mm above the dorsal hippocampus (A/P, -2000 µm; M/L, ±1300 µm; D/V, 1000 µm). Guides were permanently fixed to the skull with dental cement and two jewel screws and were obturated by appropriate stylets until behavioral manipulations. After surgery, mice were allowed to recover for at least 2 weeks. For infusions, the stylets obtruding the guide cannulae were removed. Stainless-steel cannulae (32 gauge, 9 mm) attached to 1 µl Hamilton syringes (PolyLabo, Strasbourg, France) with polyethylene catheter tubing were inserted through the guide cannulae. The syringes were fixed in a constant rate infusion pump. Each mouse was given bilateral infusions of 0.9% saline (Vehicle, Veh, 0.3µl/side) or 4% Lidocaine (Lido, Sigma, 0.3µl/side) into the dorsal hippocampus. I...
At the end of experiments, mice were perfused transcardially with a phosphate-buffered solution of 4% paraformaldehyde and brains were cut on a vibratome (40 µm thick sections). For each staining, one in ten free-floating sections was processed according to a standard immunohistochemical procedure. HH3 immunoreactivity (IR), nestin-IR, activated caspase 3-IR, Dcx-IR, CD11b-IR or PECAM-1-IR were revealed using respectively a rabbit anti-HH3 polyclonal antibody (1∶2000, Upstate), a mouse anti-nestin monoclonal antibody (1∶1000; Chemicon), a rabbit anti-activated caspase 3 polyclonal antibody (1:500, Cell signaling technology), a sheep anti-Dcx polyclonal antibody (1∶2000; SantaCruz), a rat anti-mouse CD11b monoclonal antibody (1∶1000; Serotec) and a rat anti-mouse PECAM-1 monoclonal antibody (1:500; Pharmingen). For BrdU labeling, sections were treated with 2N HCl (30 min at 37°C) and then incubated with a rat monoclonal anti-BrdU antibody (1∶2000, Accurate, New York, USA). For each staining, sections were processed in parallel and immunoreactivities were visualized by the biotin-streptavidin technique (ABC kit, Dako) using 3,3′-diami...
Machine-readable layer
[
{
"@context": "https://schema.org",
"@type": "HowTo",
"name": "Spatial Relational Memory Requires Hippocampal Adult Neurogenesis methods",
"description": "Evidence-backed execution summary for Spatial Relational Memory Requires Hippocampal Adult Neurogenesis methods from Spatial Relational Memory Requires Hippocampal Adult Neurogenesis.",
"totalTime": "PT38435M",
"step": [
{
"@type": "HowToStep",
"position": 1,
"name": "Fluorescence Resonance Energy Transfer",
"text": "FRET analysis of Bax multimers was used to track the intermolecular interaction between ECFPBax and EYFPBax fusion proteins. For cultured CHO cells, FRET was quantified using \"Microfret\". In brief, this method consists in the acquisition of three images through i) a CFP filter set (excitation 436/10 nm, emission 470/30 nm); ii) a YFP filter set (excitation 500/20 nm, emission 535/30 nm); iii) a FRET filter set (excitation 436/10 nm, emission 535/30 nm), and the determination of the \"corrected FRET\" or FRETc value which takes into consideration the non-FRET signal caused by the overlapping of the CFP and YFP spectra. Thus, the calculation of FRETc depends on the following relationship: FRETc = IFRET-CCFP-CYFP, where IFRET corresponds to the intensity of FRET with the FRET filter set of CFP/YFP-coexpressing cells; CCFP and CYFP correspond..."
},
{
"@type": "HowToStep",
"position": 2,
"name": "Behavioral analysis",
"text": "At 14 weeks of age, 6 weeks after the beginning of the Dox treatment, independent groups of mice were tested in two separate experiments (experiments 2 and 3) for three behavioral tasks, each task being separated by a one week interval. The order of the tasks in the two experiments was changed in order to control for the possible bias due to interactions between tasks or treatment duration ( ). In experiment 2, novel environment exploration was tested twice, the first time at the beginning and the second time at the end of the behavioral sequence. Animals were then tested in a water maze followed by a fear conditioning test. In experiment 3 the opposite sequence was used. During water maze testing, in experiment 2 animals were first trained with a variable starting-point procedure, followed by a probe test, a visible platform test, and then by a constant starting point procedure befor..."
},
{
"@type": "HowToStep",
"position": 3,
"name": "Training with constant start positions",
"text": "During this test mice were also required to locate the hidden platform using distal extra-maze cues. Procedures were similar to the ones used for training with variable start positions (3 daily trials with a 60 seconds cut-off and 5 min inter-trial intervals). However this time the start position was maintained constant between trials and days of training. Also the hidden platform was localized in a different quadrant than the one used for the variable-start paradigm. When performances reached a criterion of less than 10 sec of escape latency over two successive trials (2 nd day of training in experiment 2; 8 th day of training in experiment 3), animals were tested to locate the hidden platform from a novel start position that had never been used before (1 trial with a 60 seconds cut-off)."
},
{
"@type": "HowToStep",
"position": 4,
"name": "Hippocampal inactivation",
"text": "In order to verify the hippocampal dependency of our fear conditioning procedure, supplementary groups of C57BL/6J male animals (n = 13) were implanted with bilateral hippocampal cannulae, and were injected with either lidocaine or vehicle solutions just before the conditioning session. Stainless-steel guided cannulae (26 gauge, 8 mm in length) were implanted bilaterally 1 mm above the dorsal hippocampus (A/P, -2000 µm; M/L, ±1300 µm; D/V, 1000 µm). Guides were permanently fixed to the skull with dental cement and two jewel screws and were obturated by appropriate stylets until behavioral manipulations. After surgery, mice were allowed to recover for at least 2 weeks. For infusions, the stylets obtruding the guide cannulae were removed. Stainless-steel cannulae (32 gauge, 9 mm) attached to 1 µl Hamilton syringes (PolyLabo, Strasbourg, France)..."
},
{
"@type": "HowToStep",
"position": 5,
"name": "Immunohistochemistry",
"text": "At the end of experiments, mice were perfused transcardially with a phosphate-buffered solution of 4% paraformaldehyde and brains were cut on a vibratome (40 µm thick sections). For each staining, one in ten free-floating sections was processed according to a standard immunohistochemical procedure. HH3 immunoreactivity (IR), nestin-IR, activated caspase 3-IR, Dcx-IR, CD11b-IR or PECAM-1-IR were revealed using respectively a rabbit anti-HH3 polyclonal antibody (1∶2000, Upstate), a mouse anti-nestin monoclonal antibody (1∶1000; Chemicon), a rabbit anti-activated caspase 3 polyclonal antibody (1:500, Cell signaling technology), a sheep anti-Dcx polyclonal antibody (1∶2000; SantaCruz), a rat anti-mouse CD11b monoclonal antibody (1∶1000; Serotec) and a rat anti-mouse PECAM-1 monoclonal antibody (1:500; Pharmingen). For BrdU labeling, sections were treated with..."
}
],
"tool": [
{
"@type": "HowToTool",
"name": "Inhibition of adult hippocampal neurogenesis alters spatial relational memory"
},
{
"@type": "HowToTool",
"name": "Inhibition of adult hippocampal neurogenesis alters spatial relational memory"
},
{
"@type": "HowToTool",
"name": "Discussion"
},
{
"@type": "HowToTool",
"name": "Adult-born neurons influence spatial relational memory"
},
{
"@type": "HowToTool",
"name": "Fluorescence Resonance Energy Transfer"
},
{
"@type": "HowToTool",
"name": "Behavioral analysis"
},
{
"@type": "HowToTool",
"name": "Training with constant start positions"
},
{
"@type": "HowToTool",
"name": "Stereological analysis"
}
],
"supply": [
{
"@type": "HowToSupply",
"name": "Materials and Methods"
},
{
"@type": "HowToSupply",
"name": "Hippocampal inactivation"
},
{
"@type": "HowToSupply",
"name": "Immunohistochemistry"
}
],
"isBasedOn": {
"@type": "ScholarlyArticle",
"headline": "Spatial Relational Memory Requires Hippocampal Adult Neurogenesis",
"datePublished": "2008",
"author": [
{
"@type": "Person",
"name": "David Dupret"
},
{
"@type": "Person",
"name": "Jean-Michel Revest"
},
{
"@type": "Person",
"name": "Muriel Koehl"
},
{
"@type": "Person",
"name": "François Ichas"
},
{
"@type": "Person",
"name": "Francesca De Giorgi"
},
{
"@type": "Person",
"name": "Pierre Costet"
},
{
"@type": "Person",
"name": "Djoher Nora Abrous"
},
{
"@type": "Person",
"name": "Pier Vincenzo Piazza"
}
],
"identifier": "10.1371/journal.pone.0001959"
}
},
{
"@context": "https://schema.org",
"@type": "BreadcrumbList",
"itemListElement": [
{
"@type": "ListItem",
"position": 1,
"name": "Experiments",
"item": "https://replicatescience.com/experiments"
},
{
"@type": "ListItem",
"position": 2,
"name": "Spatial Relational Memory Requires Hippocampal Adult Neurogenesis methods",
"item": "https://replicatescience.com/experiments/spatial-relational-memory-requires-hippocampal-adult-neurogenesis-methods-david-dupret-pmc2396793/spatial-relational-memory-requires-hippocampal-adult-neurogenesis-mlpgwh8r"
}
]
}
]