The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions methods
Aim. Evidence-backed execution summary for The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions methods from The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions.
Show snapshot details
On this page
This experiment, in seven questions
Jump straight to the part of the recipe you need. Data and provenance labels stay close to the action they support.
Shopping and prep list
What do I need before I start?
mouse
Subject model for the experiment.
- Use
- confirm full cohort details in the source paper
Cells.
reagent used in the protocol.
- Use
- Mice were killed 3 h and on days 1-5, 7, and 16 after myocardial infarction ( n = 3-10 mice per time point). Peripheral blood was drawn via cardiac puncture with citrate solution (100 mM Na-citrate, 130 mM glucose, pH 6.5), as anti-coagulant and mononuclear cells were purified by density centrifugation (...
mAbs and flow cytometry.
reagent used in the protocol.
- Use
- The following antibodies were used: anti-CD90-PE, 53-2.1 (BD Biosciences), -B220-PE, RA3-6B2 (BD Biosciences),-CD49b-PE, DX5 (BD Biosciences), -NK1.1-PE, PK136 (BD Biosciences), -Ly-6G-PE, 1A8 (BD Biosciences), -Ly-6G-FITC, 1A8 (BD Biosciences), CD11b-APC, M1/70 (BD Bioscien...
Histopathological analysis.
reagent used in the protocol.
- Use
- Histopathology for assessment of healing was performed in mice killed 7 d after MI for the following groups: wild-type C57BL/6 mice, wild-type mice depleted with clodronate-loaded liposomes immediately after coronary ligation, wild-type mice depleted with clodronate-loaded liposomes 3 d after MI, and apoE -/&#...
Real-time RT-PCR.
reagent used in the protocol.
- Use
- Primer sequences and probes for MCP-1 (forward, GGCTCAGCCAGATGCAGTTAA; reverse, CCTACTCATTGGGATCATCTTGCT; probe, CCCCACTCACCTGCTGCTACTCATTCA [Fam-Tamra]); MIP-1α (Fwd: TCTTCTCAGCGCCATATGGA, Rev: CGTGGAATCTTCCGGCTGTA, Probe: CTGACACCCCGACTGCCTGCTG (Fam-Tamra)), Fractalkine (forward, CCAGGGTCCTTTCCTGTCTCT; revers...
The injured myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes through modulation of chemokin...
Sequential recruitment of Ly-6C hi and -6C lo monocytes depends on CCR2 and CX 3 CR1, respectively. (A) RT-PCR expression profile of MCP-1, MIP-1α, fractalkine, and VCAM-1 in the heart tissue before MI and during phase I (day 1) and II (day 4). (B) Monocyte subset expression profile of CCR2, CCR5, CX 3 CR1 (for...
- Use
- Sequential recruitment of Ly-6C hi and -6C lo monocytes depends on CCR2 and CX 3 CR1, respectively. (A) RT-PCR expression profile of MCP-1, MIP-1α, fractalkine, and VCAM-1 in the heart tissue before MI and during phase I (day 1) and II (day 4). (B) Monocyte subset expression profile of CCR2, CCR5, CX 3 CR1 (for...
In vivo relevance of the biphasic response to healing
The sequential recruitment of monocyte subsets to the infarct, combined with their differential functional properties in circulation, suggests differential roles in healing. Because both subsets are phagocytic, and because each phase occurs in a defined time frame, we elected to investigate the impact of each phase...
- Use
- The sequential recruitment of monocyte subsets to the infarct, combined with their differential functional properties in circulation, suggests differential roles in healing. Because both subsets are phagocytic, and because each phase occurs in a defined time frame, we elected to investigate the impact of each phase...
mAbs and flow cytometry.
The following antibodies were used: anti-CD90-PE, 53-2.1 (BD Biosciences), -B220-PE, RA3-6B2 (BD Biosciences),-CD49b-PE, DX5 (BD Biosciences), -NK1.1-PE, PK136 (BD Biosciences), -Ly-6G-PE, 1A8 (BD Biosciences), -Ly-6G-FITC, 1A8 (BD Biosciences), CD11b-APC, M1/70 (BD Bioscien...
- Use
- The following antibodies were used: anti-CD90-PE, 53-2.1 (BD Biosciences), -B220-PE, RA3-6B2 (BD Biosciences),-CD49b-PE, DX5 (BD Biosciences), -NK1.1-PE, PK136 (BD Biosciences), -Ly-6G-PE, 1A8 (BD Biosciences), -Ly-6G-FITC, 1A8 (BD Biosciences), CD11b-APC, M1/70 (BD Bioscien...
Monocyte subtype tracking.
Ly-6C hi or -6C lo monocytes were sorted from the spleen of C57BL/6 mice on a FACSAria (BD Biosciences) and labeled with 111 In-oxine according to the manufacturer's protocol (GE Healthcare). In brief, cells were washed with HBSS, spun, and resuspended in 111 In-oxine for 15 min at 37°C, pH 6.5-7.5, and w...
- Use
- Ly-6C hi or -6C lo monocytes were sorted from the spleen of C57BL/6 mice on a FACSAria (BD Biosciences) and labeled with 111 In-oxine according to the manufacturer's protocol (GE Healthcare). In brief, cells were washed with HBSS, spun, and resuspended in 111 In-oxine for 15 min at 37°C, pH 6.5-7.5, and w...
Histopathological analysis.
Histopathology for assessment of healing was performed in mice killed 7 d after MI for the following groups: wild-type C57BL/6 mice, wild-type mice depleted with clodronate-loaded liposomes immediately after coronary ligation, wild-type mice depleted with clodronate-loaded liposomes 3 d after MI, and apoE -/&#...
- Use
- Histopathology for assessment of healing was performed in mice killed 7 d after MI for the following groups: wild-type C57BL/6 mice, wild-type mice depleted with clodronate-loaded liposomes immediately after coronary ligation, wild-type mice depleted with clodronate-loaded liposomes 3 d after MI, and apoE -/&#...
Real-time RT-PCR.
Primer sequences and probes for MCP-1 (forward, GGCTCAGCCAGATGCAGTTAA; reverse, CCTACTCATTGGGATCATCTTGCT; probe, CCCCACTCACCTGCTGCTACTCATTCA [Fam-Tamra]); MIP-1α (Fwd: TCTTCTCAGCGCCATATGGA, Rev: CGTGGAATCTTCCGGCTGTA, Probe: CTGACACCCCGACTGCCTGCTG (Fam-Tamra)), Fractalkine (forward, CCAGGGTCCTTTCCTGTCTCT; revers...
- Use
- Primer sequences and probes for MCP-1 (forward, GGCTCAGCCAGATGCAGTTAA; reverse, CCTACTCATTGGGATCATCTTGCT; probe, CCCCACTCACCTGCTGCTACTCATTCA [Fam-Tamra]); MIP-1α (Fwd: TCTTCTCAGCGCCATATGGA, Rev: CGTGGAATCTTCCGGCTGTA, Probe: CTGACACCCCGACTGCCTGCTG (Fam-Tamra)), Fractalkine (forward, CCAGGGTCCTTTCCTGTCTCT; revers...
Before you run
What should be confirmed before execution?
First confirmation
Equipment is listed but no product mappings are linked.
Confirm before execution
This page is backed by a publishable Replication Data Ledger package with zero critical source-verification issues.
Confirm before execution
Open the source paper before finalizing run-specific details.
Procurement checkpoint
Use source-stated vendors where present. Treat mapped products as sourcing options unless the page marks an exact source match.
Open quote workflowStep-by-step procedure
What do I do, in order?
The injured myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes through modulation of chemokin...
Several mechanisms might explain the selective mobilization of Ly-6C hi monocytes during phase I and Ly-6C lo monocytes during phase II. For instance, the injured myocardium may recruit Ly-6C hi cells that convert into Ly-6C lo cells at the onset of phase II. The myocardium may also recruit circulating Ly-6C hi and -6C lo cells sequentially; a biphasic recruitment of monocytes could result from alterations in the relative number of these cells in peripheral blood and/or from preferential recruitment to the target tissue. To address these issues, we sought to determine how circulating Ly-6C hi and -6C lo monocytes contribute to the pool of monocytes/macrophages in injured hearts, and we measured the following two parameters at the onset of phase I and II: (a) the relative abundance of Ly-6C hi and -6C lo monocytes in the blood, and (b) the intrinsic probability (i.e., on a cell-c...
Cells.
Mice were killed 3 h and on days 1-5, 7, and 16 after myocardial infarction ( n = 3-10 mice per time point). Peripheral blood was drawn via cardiac puncture with citrate solution (100 mM Na-citrate, 130 mM glucose, pH 6.5), as anti-coagulant and mononuclear cells were purified by density centrifugation ( ). Total blood leukocyte numbers were determined using acetic acid lysis solution (3% HEMA 3 Solution II, 94% ddH 2 O, and 3% glacial acetic acid). Spleens were removed, triturated in HBSS (Mediatech, Inc.) at 4°C with the end of a 3-ml syringe, and filtered through nylon mesh (BD Biosciences). The cell suspension was centrifuged at 300 g for 10 min at 4°C. Red blood cells were lysed with ACK lysis buffer, and the splenocytes were washed with HBSS and resuspended in HBSS supplemented with 0.2% (wt/vol) BSA and 1% (wt/vol) FCS. Infarct tissue and healthy hearts we...
mAbs and flow cytometry.
The following antibodies were used: anti-CD90-PE, 53-2.1 (BD Biosciences), -B220-PE, RA3-6B2 (BD Biosciences),-CD49b-PE, DX5 (BD Biosciences), -NK1.1-PE, PK136 (BD Biosciences), -Ly-6G-PE, 1A8 (BD Biosciences), -Ly-6G-FITC, 1A8 (BD Biosciences), CD11b-APC, M1/70 (BD Biosciences), -F4/80-biotin, C1:A3-1 (AbD Serotec), -F4/80-FITC, C1:A3-1 (BioLegend), -CD11c-biotin, HL3 (BD Biosciences), -CD11c-FITC, HL3 (BD Biosciences), -I-A b -biotin, AF6-120.1 (BD Biosciences), -I-A b -FITC, AF6-120.1 (BD Biosciences), -Ly-6C-FITC, AL-21 (BD Biosciences), -Ly-6C-biotin, AL-21 (BD Biosciences), TNF-α-FITC, MP6-XT22 (AbD Serotec), anti-CD43-FITC, S7 (BD Biosciences), -CD62L-FITC, MEL-14 (BD Biosciences), -CD68-FITC, FA-11 (AbD Serotec), -CD86-biotin, GL1 (BD Biosciences), -CD115-PE,...
Monocyte subtype tracking.
Ly-6C hi or -6C lo monocytes were sorted from the spleen of C57BL/6 mice on a FACSAria (BD Biosciences) and labeled with 111 In-oxine according to the manufacturer's protocol (GE Healthcare). In brief, cells were washed with HBSS, spun, and resuspended in 111 In-oxine for 15 min at 37°C, pH 6.5-7.5, and washed twice with HBSS. 111 In-oxine is a widely used, FDA-approved agent that is fully biocompatible as it alters neither cell survival nor function at the doses used (,,, ); hence, we considered labeled monocytes to behave similarly to unlabeled monocytes. Approximately 2 × 10 5 Ly-6C hi or -6C lo monocytes incorporating 20 µCi were injected independently i.v. into C57BL/6 on day 0 (phase I) or 4 d (phase II) after MI. The total amount of activity injected into each animal was measured with a radioisotope calibrator (Capintec, Inc.). After 24 h, recipient anim...
Histopathological analysis.
Histopathology for assessment of healing was performed in mice killed 7 d after MI for the following groups: wild-type C57BL/6 mice, wild-type mice depleted with clodronate-loaded liposomes immediately after coronary ligation, wild-type mice depleted with clodronate-loaded liposomes 3 d after MI, and apoE -/- C57BL6 mice. Hearts were excised and rinsed in PBS and embedded in OCT (Sakura Finetek). Serial 6-µm thick sections were used for immunohistochemical staining for neutrophils (NIMP-R14, Abcam), monocytes/macrophages (Mac-3, M3/84; BD PharMingen), myofibroblasts (α-actin, RB-9010-PO; Neomarkers), and endothelial cells forming capillaries (CD31, MEC13.3; BD Biosciences). Reaction was visualized as a three-step staining procedure in combination with biotinylated secondary antibodies (BA4001; Vector Laboratories) and AEC Substrate kit (Vector Laboratories). To a...
Measurement outputs
What raw and processed outputs should exist?
Several mechanisms might explain the selective mobilization of Ly-6C hi monocytes during phase I and Ly-6C lo monocytes during phase II. For instance, the injured myocardium may...
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
The ischemic myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes. (A) Number of total leukocytes in peripheral blood of C57BL/6 mice before MI and at the...
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
The mechanisms driving monocyte accumulation in hearts are different in phase I and II. The dominance of Ly-6C hi monocytes in hearts in phase I is driven by selective expansion...
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
Sequential recruitment of monocyte subsets to the infarct suggests coordinated orchestration by chemokines, leukocyte adhesion molecules, and their cognate receptors. We tested...
- Raw artifact
- Per-sample or per-animal endpoint measurements collected during the experiment
- Processed artifact
- Structured table with cleaned measurements ready for comparison
- Reported as
- Summary statistics and between-group or across-timepoint comparisons
Analysis plan
How should the outputs become interpretable results?
Acquisition
Collect raw experimental outputs with enough metadata to preserve sample identity, condition, and timing.
inferred from protocolPreprocessing / cleaning
The ischemic myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes.
from paperScoring or quantification
Quantify the primary readouts for this experiment: Several mechanisms might explain the selective mobilization of Ly-6C hi monocytes during phase I and Ly-6C lo monocytes during phase II. For instance, the injured myocardium may...; The ischemic myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes. (A) Number of total leukocytes in peripheral blood of C57BL/6 mice before MI and at the...; The mechanisms driving monocyte accumulation in hearts are different in phase I and II. The dominance of Ly-6C hi monocytes in hearts in phase I is driven by selective expansion...; Sequential recruitment of monocyte subsets to the infarct suggests coordinated orchestration by chemokines, leukocyte adhesion molecules, and their cognate receptors. We tested....
from paperStatistical comparison
The ischemic myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes. (A) Number of total leukocytes in peripheral blood of C57BL/6 mice before MI and at the...; Sequential recruitment of Ly-6C hi and -6C lo monocytes depends on CCR2 and CX 3 CR1, respectively. (A) RT-PCR expression profile of MCP-1, MIP-1α, fractalkine, and VCAM-1...; Ly-6C hi and -6C lo monocytes commit for different functions. Relative phagocytic activity, MMP activity, cathepsin activity, TNF-α production (with or without stimulation...; In vivo relevance of the biphasic response to healing. (A) Representative dot plots from individual mice depict Ly-6C hi monocytes (bottom right), Ly-6C lo monocytes (bottom lef...
from paperReporting output
Report representative outputs alongside summary comparisons for Several mechanisms might explain the selective mobilization of Ly-6C hi monocytes during phase I and Ly-6C lo monocytes during phase II. For instance, the injured myocardium may..., The ischemic myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes. (A) Number of total leukocytes in peripheral blood of C57BL/6 mice before MI and at the..., The mechanisms driving monocyte accumulation in hearts are different in phase I and II. The dominance of Ly-6C hi monocytes in hearts in phase I is driven by selective expansion..., Sequential recruitment of monocyte subsets to the infarct suggests coordinated orchestration by chemokines, leukocyte adhesion molecules, and their cognate receptors. We tested....
inferred from protocolStructured statistical methods
The ischemic myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes. (A) Number of total leukocytes in peripheral blood of C57BL/6 mice before MI and at the...; Sequential recruitment of Ly-6C hi and -6C lo monocytes depends on CCR2 and CX 3 CR1, respectively. (A) RT-PCR expression profile of MCP-1, MIP-1α, fractalkine, and VCAM-1...; Ly-6C hi and -6C lo monocytes commit for different functions. Relative phagocytic activity, MMP activity, cathepsin activity, TNF-α production (with or without stimulation...; In vivo relevance of the biphasic response to healing. (A) Representative dot plots from individual mice depict Ly-6C hi monocytes (bottom right), Ly-6C lo monocytes (bottom lef...
source structuredSource and audit
What supports the facts on this page?
Evidence quotes (5)
Several mechanisms might explain the selective mobilization of Ly-6C hi monocytes during phase I and Ly-6C lo monocytes during phase II. For instance, the injured myocardium may recruit Ly-6C hi cells that convert into Ly-6C lo cells at the onset of phase II. The myocardium may also recruit circulating Ly-6C hi and -6C lo cells sequentially; a biphasic recruitment of monocytes could result from alterations in the relative number of these cells in peripheral blood and/or from preferential recruitment to the target tissue. To address these issues, we sought to determine how circulating Ly-6C hi and -6C lo monocytes contribute to the pool of monocytes/macrophages in injured hearts, and we measured the following two parameters at the onset of phase I and II: (a) the relative abundance of Ly-6C hi and -6C lo monocytes in the blood, and (b) the intrinsic probability (i.e., on a cell-cell basis) of circulating Ly-6C hi and -6C lo monocytes being recruited to injured hearts. To this end, we first analyzed peripheral blood mononuclear cells ex vivo; although the total leukocyte numbers remained relatively stable over time ( ), myocardial infarction triggered acute Ly-6C hi monocyto...
Mice were killed 3 h and on days 1-5, 7, and 16 after myocardial infarction ( n = 3-10 mice per time point). Peripheral blood was drawn via cardiac puncture with citrate solution (100 mM Na-citrate, 130 mM glucose, pH 6.5), as anti-coagulant and mononuclear cells were purified by density centrifugation ( ). Total blood leukocyte numbers were determined using acetic acid lysis solution (3% HEMA 3 Solution II, 94% ddH 2 O, and 3% glacial acetic acid). Spleens were removed, triturated in HBSS (Mediatech, Inc.) at 4°C with the end of a 3-ml syringe, and filtered through nylon mesh (BD Biosciences). The cell suspension was centrifuged at 300 g for 10 min at 4°C. Red blood cells were lysed with ACK lysis buffer, and the splenocytes were washed with HBSS and resuspended in HBSS supplemented with 0.2% (wt/vol) BSA and 1% (wt/vol) FCS. Infarct tissue and healthy hearts were harvested, minced with fine scissors, and placed into a cocktail of collagenase I, collagenase XI, DNase I, and hyaluronidase (Sigma-Aldrich) and shaken at 37°C for 1 h, as previously described ( ). Cells were then triturated through nylon mesh and centrifuged (15 min, 500 g, 4°C). Tot...
The following antibodies were used: anti-CD90-PE, 53-2.1 (BD Biosciences), -B220-PE, RA3-6B2 (BD Biosciences),-CD49b-PE, DX5 (BD Biosciences), -NK1.1-PE, PK136 (BD Biosciences), -Ly-6G-PE, 1A8 (BD Biosciences), -Ly-6G-FITC, 1A8 (BD Biosciences), CD11b-APC, M1/70 (BD Biosciences), -F4/80-biotin, C1:A3-1 (AbD Serotec), -F4/80-FITC, C1:A3-1 (BioLegend), -CD11c-biotin, HL3 (BD Biosciences), -CD11c-FITC, HL3 (BD Biosciences), -I-A b -biotin, AF6-120.1 (BD Biosciences), -I-A b -FITC, AF6-120.1 (BD Biosciences), -Ly-6C-FITC, AL-21 (BD Biosciences), -Ly-6C-biotin, AL-21 (BD Biosciences), TNF-α-FITC, MP6-XT22 (AbD Serotec), anti-CD43-FITC, S7 (BD Biosciences), -CD62L-FITC, MEL-14 (BD Biosciences), -CD68-FITC, FA-11 (AbD Serotec), -CD86-biotin, GL1 (BD Biosciences), -CD115-PE, 604B5-2E11 (AbD Serotec), -Mac-3-FITC, M3/84 (BD Biosciences), -Gr-1-PeCy7, RB6-8C5 (BD Biosciences). Strep-PerCP (BD Biosciences) was used to label biotinylated antibodies. Monocytes were identified as CD11b hi (CD90/B220/CD49b/NK1.1/Ly-6G) lo (F4/80/I-A b /CD11c) lo Ly-6C hi/lo. Macro...
Ly-6C hi or -6C lo monocytes were sorted from the spleen of C57BL/6 mice on a FACSAria (BD Biosciences) and labeled with 111 In-oxine according to the manufacturer's protocol (GE Healthcare). In brief, cells were washed with HBSS, spun, and resuspended in 111 In-oxine for 15 min at 37°C, pH 6.5-7.5, and washed twice with HBSS. 111 In-oxine is a widely used, FDA-approved agent that is fully biocompatible as it alters neither cell survival nor function at the doses used (,,, ); hence, we considered labeled monocytes to behave similarly to unlabeled monocytes. Approximately 2 × 10 5 Ly-6C hi or -6C lo monocytes incorporating 20 µCi were injected independently i.v. into C57BL/6 on day 0 (phase I) or 4 d (phase II) after MI. The total amount of activity injected into each animal was measured with a radioisotope calibrator (Capintec, Inc.). After 24 h, recipient animals were killed with CO 2 and hearts were collected. cpm for each heart were measured using a 1480 Wizard Wallac Gamma Counter (PerkinElmer Life and Analytical Sciences, Inc.). Percent-injected dose per gram tissue (%ID/g) was calculated after correcting for decay, excretion, and tail radioactivity...
Histopathology for assessment of healing was performed in mice killed 7 d after MI for the following groups: wild-type C57BL/6 mice, wild-type mice depleted with clodronate-loaded liposomes immediately after coronary ligation, wild-type mice depleted with clodronate-loaded liposomes 3 d after MI, and apoE -/- C57BL6 mice. Hearts were excised and rinsed in PBS and embedded in OCT (Sakura Finetek). Serial 6-µm thick sections were used for immunohistochemical staining for neutrophils (NIMP-R14, Abcam), monocytes/macrophages (Mac-3, M3/84; BD PharMingen), myofibroblasts (α-actin, RB-9010-PO; Neomarkers), and endothelial cells forming capillaries (CD31, MEC13.3; BD Biosciences). Reaction was visualized as a three-step staining procedure in combination with biotinylated secondary antibodies (BA4001; Vector Laboratories) and AEC Substrate kit (Vector Laboratories). To analyze the collagen content of the scar, sections were stained with PSR. Collagen content was visualized with polarized light ( ). Necrotic debris was analyzed on Masson trichrome-stained sections. Neutrophils, macrophages, and myofibroblasts (magnification 400 × ) and collagen content and...
Machine-readable layer
[
{
"@context": "https://schema.org",
"@type": "HowTo",
"name": "The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions methods",
"description": "Evidence-backed execution summary for The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions methods from The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions.",
"totalTime": "PT25M",
"step": [
{
"@type": "HowToStep",
"position": 1,
"name": "The injured myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes through modulation of chemokin...",
"text": "Several mechanisms might explain the selective mobilization of Ly-6C hi monocytes during phase I and Ly-6C lo monocytes during phase II. For instance, the injured myocardium may recruit Ly-6C hi cells that convert into Ly-6C lo cells at the onset of phase II. The myocardium may also recruit circulating Ly-6C hi and -6C lo cells sequentially; a biphasic recruitment of monocytes could result from alterations in the relative number of these cells in peripheral blood and/or from preferential recruitment to the target tissue. To address these issues, we sought to determine how circulating Ly-6C hi and -6C lo monocytes contribute to the pool of monocytes/macrophages in injured hearts, and we measured the following two parameters at the onset of phase I and II: (a) the relative abundance of Ly-6C hi and -6C lo monocytes in the blood, and (b) the intrinsic probability (i.e., on a cell-c..."
},
{
"@type": "HowToStep",
"position": 2,
"name": "Cells.",
"text": "Mice were killed 3 h and on days 1-5, 7, and 16 after myocardial infarction ( n = 3-10 mice per time point). Peripheral blood was drawn via cardiac puncture with citrate solution (100 mM Na-citrate, 130 mM glucose, pH 6.5), as anti-coagulant and mononuclear cells were purified by density centrifugation ( ). Total blood leukocyte numbers were determined using acetic acid lysis solution (3% HEMA 3 Solution II, 94% ddH 2 O, and 3% glacial acetic acid). Spleens were removed, triturated in HBSS (Mediatech, Inc.) at 4°C with the end of a 3-ml syringe, and filtered through nylon mesh (BD Biosciences). The cell suspension was centrifuged at 300 g for 10 min at 4°C. Red blood cells were lysed with ACK lysis buffer, and the splenocytes were washed with HBSS and resuspended in HBSS supplemented with 0.2% (wt/vol) BSA and 1% (wt/vol) FCS. Infarct tissue and healthy hearts we..."
},
{
"@type": "HowToStep",
"position": 3,
"name": "mAbs and flow cytometry.",
"text": "The following antibodies were used: anti-CD90-PE, 53-2.1 (BD Biosciences), -B220-PE, RA3-6B2 (BD Biosciences),-CD49b-PE, DX5 (BD Biosciences), -NK1.1-PE, PK136 (BD Biosciences), -Ly-6G-PE, 1A8 (BD Biosciences), -Ly-6G-FITC, 1A8 (BD Biosciences), CD11b-APC, M1/70 (BD Biosciences), -F4/80-biotin, C1:A3-1 (AbD Serotec), -F4/80-FITC, C1:A3-1 (BioLegend), -CD11c-biotin, HL3 (BD Biosciences), -CD11c-FITC, HL3 (BD Biosciences), -I-A b -biotin, AF6-120.1 (BD Biosciences), -I-A b -FITC, AF6-120.1 (BD Biosciences), -Ly-6C-FITC, AL-21 (BD Biosciences), -Ly-6C-biotin, AL-21 (BD Biosciences), TNF-α-FITC, MP6-XT22 (AbD Serotec), anti-CD43-FITC, S7 (BD Biosciences), -CD62L-FITC, MEL-14 (BD Biosciences), -CD68-FITC, FA-11 (AbD Serotec), -CD86-biotin, GL1 (BD Biosciences), -CD115-PE,..."
},
{
"@type": "HowToStep",
"position": 4,
"name": "Monocyte subtype tracking.",
"text": "Ly-6C hi or -6C lo monocytes were sorted from the spleen of C57BL/6 mice on a FACSAria (BD Biosciences) and labeled with 111 In-oxine according to the manufacturer's protocol (GE Healthcare). In brief, cells were washed with HBSS, spun, and resuspended in 111 In-oxine for 15 min at 37°C, pH 6.5-7.5, and washed twice with HBSS. 111 In-oxine is a widely used, FDA-approved agent that is fully biocompatible as it alters neither cell survival nor function at the doses used (,,, ); hence, we considered labeled monocytes to behave similarly to unlabeled monocytes. Approximately 2 × 10 5 Ly-6C hi or -6C lo monocytes incorporating 20 µCi were injected independently i.v. into C57BL/6 on day 0 (phase I) or 4 d (phase II) after MI. The total amount of activity injected into each animal was measured with a radioisotope calibrator (Capintec, Inc.). After 24 h, recipient anim..."
},
{
"@type": "HowToStep",
"position": 5,
"name": "Histopathological analysis.",
"text": "Histopathology for assessment of healing was performed in mice killed 7 d after MI for the following groups: wild-type C57BL/6 mice, wild-type mice depleted with clodronate-loaded liposomes immediately after coronary ligation, wild-type mice depleted with clodronate-loaded liposomes 3 d after MI, and apoE -/- C57BL6 mice. Hearts were excised and rinsed in PBS and embedded in OCT (Sakura Finetek). Serial 6-µm thick sections were used for immunohistochemical staining for neutrophils (NIMP-R14, Abcam), monocytes/macrophages (Mac-3, M3/84; BD PharMingen), myofibroblasts (α-actin, RB-9010-PO; Neomarkers), and endothelial cells forming capillaries (CD31, MEC13.3; BD Biosciences). Reaction was visualized as a three-step staining procedure in combination with biotinylated secondary antibodies (BA4001; Vector Laboratories) and AEC Substrate kit (Vector Laboratories). To a..."
}
],
"tool": [
{
"@type": "HowToTool",
"name": "The injured myocardium sequentially recruits circulating Ly-6C hi and -6C lo monocytes through modulation of chemokin..."
},
{
"@type": "HowToTool",
"name": "In vivo relevance of the biphasic response to healing"
},
{
"@type": "HowToTool",
"name": "mAbs and flow cytometry."
},
{
"@type": "HowToTool",
"name": "Monocyte subtype tracking."
},
{
"@type": "HowToTool",
"name": "Histopathological analysis."
},
{
"@type": "HowToTool",
"name": "Real-time RT-PCR."
}
],
"supply": [
{
"@type": "HowToSupply",
"name": "Cells."
},
{
"@type": "HowToSupply",
"name": "mAbs and flow cytometry."
},
{
"@type": "HowToSupply",
"name": "Histopathological analysis."
},
{
"@type": "HowToSupply",
"name": "Real-time RT-PCR."
}
],
"isBasedOn": {
"@type": "ScholarlyArticle",
"headline": "The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions",
"datePublished": "2007",
"author": [
{
"@type": "Person",
"name": "Matthias Nahrendorf"
},
{
"@type": "Person",
"name": "Filip K. Swirski"
},
{
"@type": "Person",
"name": "Elena Aikawa"
},
{
"@type": "Person",
"name": "Lars Stangenberg"
},
{
"@type": "Person",
"name": "Thomas Wurdinger"
},
{
"@type": "Person",
"name": "Jose-Luiz Figueiredo"
},
{
"@type": "Person",
"name": "Peter Libby"
},
{
"@type": "Person",
"name": "Ralph Weissleder"
},
{
"@type": "Person",
"name": "Mikael J. Pittet"
}
],
"identifier": "10.1084/jem.20070885"
}
},
{
"@context": "https://schema.org",
"@type": "BreadcrumbList",
"itemListElement": [
{
"@type": "ListItem",
"position": 1,
"name": "Experiments",
"item": "https://replicatescience.com/experiments"
},
{
"@type": "ListItem",
"position": 2,
"name": "The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions methods",
"item": "https://replicatescience.com/experiments/the-healing-myocardium-sequentially-mobilizes-two-monocyte-subsets-with-divergent-and-complementary-functions-methods-matthias-nahrendorf-pmc2118517/the-healing-myocardium-sequentially-mobilizes-two-monocyte-subsets-with-divergent-and-complementary--mlph0xu3"
}
]
}
]